Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215937004:

Variant ID: vg1215937004 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15937004
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGAAATCGGGTATGCGTCCCAGATAACAGAGAACTTAAACAGCTGATACTTCAGGAAGCTCACGAAAGTCCTTATTCCATCCACCCTGGCAGTACAAA[A/G]
ATGTACTTAGACTTGAAAGAGAAATACTGGTGGGTTAGCATGAAGCGGGAGATTGCAGAGTTCGTGGCCCTGTGTGATGTGTGCCAGCGTGTCAAGGCAG

Reverse complement sequence

CTGCCTTGACACGCTGGCACACATCACACAGGGCCACGAACTCTGCAATCTCCCGCTTCATGCTAACCCACCAGTATTTCTCTTTCAAGTCTAAGTACAT[T/C]
TTTGTACTGCCAGGGTGGATGGAATAAGGACTTTCGTGAGCTTCCTGAAGTATCAGCTGTTTAAGTTCTCTGTTATCTGGGACGCATACCCGATTTCCGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.90%	0.10%	12.27%	58.70%	NA
All Indica	2759	9.20%	0.20%	11.34%	79.23%	NA
All Japonica	1512	63.80%	0.10%	11.24%	24.87%	NA
Aus	269	27.10%	0.00%	21.93%	50.93%	NA
Indica I	595	10.10%	0.00%	7.90%	82.02%	NA
Indica II	465	13.80%	0.00%	9.03%	77.20%	NA
Indica III	913	4.40%	0.00%	14.57%	81.05%	NA
Indica Intermediate	786	11.60%	0.60%	11.58%	76.21%	NA
Temperate Japonica	767	94.40%	0.00%	0.78%	4.82%	NA
Tropical Japonica	504	16.30%	0.00%	25.40%	58.33%	NA
Japonica Intermediate	241	66.00%	0.40%	14.94%	18.67%	NA
VI/Aromatic	96	32.30%	0.00%	23.96%	43.75%	NA
Intermediate	90	46.70%	0.00%	16.67%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215937004	A -> DEL	LOC_Os12g27150.1	N	frameshift_variant	Average:6.26; most accessible tissue: Zhenshan97 flag leaf, score: 9.474	N	N	N	N
vg1215937004	A -> G	LOC_Os12g27150.1	synonymous_variant ; p.Lys1387Lys; LOW	synonymous_codon	Average:6.26; most accessible tissue: Zhenshan97 flag leaf, score: 9.474	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215937004	1.29E-06	2.43E-28	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	3.78E-09	1.80E-63	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	1.06E-08	5.19E-48	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	1.92E-09	2.63E-63	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	1.55E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	1.13E-08	2.32E-64	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	NA	3.15E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	NA	3.23E-37	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	NA	8.23E-72	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	NA	5.39E-54	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	2.77E-06	NA	mr1335_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215937004	NA	1.52E-13	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251