\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215915060:

Variant ID: vg1215915060 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15915060
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGATTCCTAAATTTTTACTATCATCTAACCCCAGTACTGAGGCTTCGACTTCTGCTTGTGTGTAGGCTTTGGTGGCAAGGAAGAAAAACGTGTGGATC[G/A]
TGGATTCCGGTTGTTCGCGGCACATGACCGGTGATAACTGAATCAATTATCTTTGGTGATGCTGCTACAAGTGCCGTTCTCGCTACAGGTTTGGTTAAGG

Reverse complement sequence

CCTTAACCAAACCTGTAGCGAGAACGGCACTTGTAGCAGCATCACCAAAGATAATTGATTCAGTTATCACCGGTCATGTGCCGCGAACAACCGGAATCCA[C/T]
GATCCACACGTTTTTCTTCCTTGCCACCAAAGCCTACACACAAGCAGAAGTCGAAGCCTCAGTACTGGGGTTAGATGATAGTAAAAATTTAGGAATCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 6.00% 0.61% 5.54% NA
All Indica  2759 96.30% 0.30% 0.80% 2.54% NA
All Japonica  1512 73.40% 14.00% 0.26% 12.30% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 98.50% 0.00% 1.51% 0.00% NA
Indica II  465 91.00% 0.20% 0.43% 8.39% NA
Indica III  913 97.40% 0.70% 0.33% 1.64% NA
Indica Intermediate  786 96.70% 0.30% 1.02% 2.04% NA
Temperate Japonica  767 98.40% 1.30% 0.00% 0.26% NA
Tropical Japonica  504 31.30% 34.50% 0.40% 33.73% NA
Japonica Intermediate  241 81.70% 11.60% 0.83% 5.81% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 83.30% 7.80% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215915060 G -> DEL N N silent_mutation Average:14.158; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1215915060 G -> A LOC_Os12g27120.1 intron_variant ; MODIFIER silent_mutation Average:14.158; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215915060 NA 1.20E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 3.24E-07 5.60E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 4.28E-06 1.88E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 NA 2.39E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 2.96E-07 NA mr1023 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 6.65E-08 3.11E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 1.43E-08 3.41E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 NA 2.01E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 5.52E-07 3.79E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 NA 1.51E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 9.38E-08 6.27E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 1.76E-06 8.67E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 2.49E-07 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 1.47E-06 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 NA 6.05E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 6.32E-08 3.03E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215915060 1.46E-08 1.80E-13 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251