Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215886454:

Variant ID: vg1215886454 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15886454
Reference Allele: CAlternative Allele: T,A,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TCACTCGGGCCTCCAAGGCCGTAGGACTCCTATTCGGAACCCTATCCGAATTAAGCTCATATTGGATCTCCATCCAATCCCCTTATTCCGGCCCATTAAG[C/T,A,G]
GTGCGACCCTGTAGGTTCATGTATACTCGGCTGTAACCCGAAAGCTCCTTTTCGGTCCACGCGTCAACAGCGGCACCTAGCAGAACATATTGACCCACTG

Reverse complement sequence

CAGTGGGTCAATATGTTCTGCTAGGTGCCGCTGTTGACGCGTGGACCGAAAAGGAGCTTTCGGGTTACAGCCGAGTATACATGAACCTACAGGGTCGCAC[G/A,T,C]
CTTAATGGGCCGGAATAAGGGGATTGGATGGAGATCCAATATGAGCTTAATTCGGATAGGGTTCCGAATAGGAGTCCTACGGCCTTGGAGGCCCGAGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 6.60% 0.76% 2.90% A: 0.02%
All Indica  2759 98.00% 1.10% 0.25% 0.65% A: 0.04%
All Japonica  1512 81.20% 9.20% 1.85% 7.74% NA
Aus  269 50.60% 49.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 0.90% 0.65% 3.23% NA
Indica III  913 98.80% 0.90% 0.22% 0.00% A: 0.11%
Indica Intermediate  786 97.20% 2.20% 0.25% 0.38% NA
Temperate Japonica  767 97.00% 2.70% 0.13% 0.13% NA
Tropical Japonica  504 56.50% 17.30% 5.16% 21.03% NA
Japonica Intermediate  241 82.60% 12.90% 0.41% 4.15% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 91.10% 5.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215886454 C -> DEL N N silent_mutation Average:24.271; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1215886454 C -> A LOC_Os12g27096.1 intron_variant ; MODIFIER silent_mutation Average:24.271; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1215886454 C -> G LOC_Os12g27096.1 intron_variant ; MODIFIER N Average:24.271; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg1215886454 C -> T LOC_Os12g27096.1 intron_variant ; MODIFIER silent_mutation Average:24.271; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215886454 4.40E-06 2.91E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 7.56E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 9.98E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 9.84E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 8.31E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 4.21E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.92E-07 8.22E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 6.88E-08 9.65E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 2.85E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 5.38E-07 1.46E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 2.24E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 8.82E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 1.92E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 1.16E-06 NA mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 2.67E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 1.41E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 5.50E-08 1.08E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.09E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 3.94E-06 NA mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 2.28E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 2.85E-08 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 2.66E-07 3.81E-12 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 3.65E-09 NA mr1023_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.30E-10 8.94E-17 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 2.03E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.44E-07 6.15E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 2.35E-08 NA mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 6.50E-10 9.15E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 1.72E-06 4.80E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.34E-06 9.02E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 NA 7.14E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.67E-07 6.33E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 1.68E-10 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 4.31E-10 9.80E-17 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 3.19E-07 2.40E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 1.79E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886454 7.92E-07 2.57E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251