\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215886190:

Variant ID: vg1215886190 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15886190
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATGTAGAGGAAGTAGTCGATCGCACCGGCTCGACCTTCCCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCACACCGATCAGCACCACAAACCAGCGG[C/T]
GCCTCTACCGGTATCCACACGTACAGGGACGAAACGCCACGCGCAGATGTGCTAGCACCCGCGTGCGGCTAGGGTTTTGCTCGGGGAGGGAAGTGACGGC

Reverse complement sequence

GCCGTCACTTCCCTCCCCGAGCAAAACCCTAGCCGCACGCGGGTGCTAGCACATCTGCGCGTGGCGTTTCGTCCCTGTACGTGTGGATACCGGTAGAGGC[G/A]
CCGCTGGTTTGTGGTGCTGATCGGTGTGGGAGTACGGCGAGGAGAACGCACGAGGAGGGGAAGGTCGAGCCGGTGCGATCGACTACTTCCTCTACATTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 11.50% 1.80% 0.06% NA
All Indica  2759 90.80% 8.80% 0.36% 0.00% NA
All Japonica  1512 80.60% 14.30% 4.89% 0.20% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 93.10% 6.90% 0.00% 0.00% NA
Indica II  465 96.80% 1.50% 1.72% 0.00% NA
Indica III  913 85.90% 14.10% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.40% 0.25% 0.00% NA
Temperate Japonica  767 96.30% 2.00% 1.69% 0.00% NA
Tropical Japonica  504 54.20% 34.10% 11.11% 0.60% NA
Japonica Intermediate  241 85.90% 12.00% 2.07% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215886190 C -> DEL N N silent_mutation Average:23.909; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1215886190 C -> T LOC_Os12g27096.1 intron_variant ; MODIFIER silent_mutation Average:23.909; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215886190 NA 2.40E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 NA 4.67E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 6.14E-06 4.67E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 1.29E-08 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 1.56E-07 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 8.21E-07 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 NA 7.58E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 3.85E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 2.44E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 5.21E-07 7.45E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 7.05E-09 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 4.71E-07 NA mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 NA 7.67E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 1.60E-10 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 3.59E-07 NA mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 3.06E-09 NA mr1491 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 4.37E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 9.03E-09 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 3.48E-07 NA mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 2.20E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 1.03E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 2.45E-06 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 2.40E-06 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 6.47E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 3.29E-06 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190 9.09E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251