Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215886190:

Variant ID: vg1215886190 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15886190
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAATGTAGAGGAAGTAGTCGATCGCACCGGCTCGACCTTCCCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCACACCGATCAGCACCACAAACCAGCGG[C/T]
GCCTCTACCGGTATCCACACGTACAGGGACGAAACGCCACGCGCAGATGTGCTAGCACCCGCGTGCGGCTAGGGTTTTGCTCGGGGAGGGAAGTGACGGC

Reverse complement sequence

GCCGTCACTTCCCTCCCCGAGCAAAACCCTAGCCGCACGCGGGTGCTAGCACATCTGCGCGTGGCGTTTCGTCCCTGTACGTGTGGATACCGGTAGAGGC[G/A]
CCGCTGGTTTGTGGTGCTGATCGGTGTGGGAGTACGGCGAGGAGAACGCACGAGGAGGGGAAGGTCGAGCCGGTGCGATCGACTACTTCCTCTACATTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	11.50%	1.80%	0.06%	NA
All Indica	2759	90.80%	8.80%	0.36%	0.00%	NA
All Japonica	1512	80.60%	14.30%	4.89%	0.20%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	93.10%	6.90%	0.00%	0.00%	NA
Indica II	465	96.80%	1.50%	1.72%	0.00%	NA
Indica III	913	85.90%	14.10%	0.00%	0.00%	NA
Indica Intermediate	786	91.30%	8.40%	0.25%	0.00%	NA
Temperate Japonica	767	96.30%	2.00%	1.69%	0.00%	NA
Tropical Japonica	504	54.20%	34.10%	11.11%	0.60%	NA
Japonica Intermediate	241	85.90%	12.00%	2.07%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215886190	C -> DEL	N	N	silent_mutation	Average:23.909; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg1215886190	C -> T	LOC_Os12g27096.1	intron_variant ; MODIFIER	silent_mutation	Average:23.909; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215886190	NA	2.40E-09	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	NA	4.67E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	6.14E-06	4.67E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	1.29E-08	NA	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	1.56E-07	NA	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	8.21E-07	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	NA	7.58E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	3.85E-06	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	2.44E-07	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	5.21E-07	7.45E-13	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	7.05E-09	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	4.71E-07	NA	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	NA	7.67E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	1.60E-10	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	3.59E-07	NA	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	3.06E-09	NA	mr1491	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	4.37E-06	NA	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	9.03E-09	NA	mr1778	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	3.48E-07	NA	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	2.20E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	1.03E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	2.45E-06	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	2.40E-06	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	6.47E-07	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	3.29E-06	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215886190	9.09E-06	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251