Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215881109:

Variant ID: vg1215881109 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15881109
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTAACAGTCTCCCACTTGCACTAGAGTCAATCATGAACGTATCTTATACCCATTGCCCTAGTGTGTGCCTCATGTTTAGGCTGAGGGAGTGGCTTTGT[C/T]
AATAGATCTGCAACATTCAAATCCGTATGTATTTTGCATATCTTCACATCTCCTCTACCCACTATCTCGTGAATGAGGTGATACCGCCGTAAAATGTGTT

Reverse complement sequence

AACACATTTTACGGCGGTATCACCTCATTCACGAGATAGTGGGTAGAGGAGATGTGAAGATATGCAAAATACATACGGATTTGAATGTTGCAGATCTATT[G/A]
ACAAAGCCACTCCCTCAGCCTAAACATGAGGCACACACTAGGGCAATGGGTATAAGATACGTTCATGATTGACTCTAGTGCAAGTGGGAGACTGTTAGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.30%	0.80%	28.35%	43.59%	NA
All Indica	2759	8.10%	0.10%	39.11%	52.66%	NA
All Japonica	1512	60.90%	2.20%	7.61%	29.30%	NA
Aus	269	26.00%	0.00%	28.25%	45.72%	NA
Indica I	595	2.40%	0.30%	17.65%	79.66%	NA
Indica II	465	17.80%	0.00%	29.03%	53.12%	NA
Indica III	913	4.20%	0.20%	63.86%	31.76%	NA
Indica Intermediate	786	11.20%	0.00%	32.57%	56.23%	NA
Temperate Japonica	767	88.90%	3.00%	2.74%	5.35%	NA
Tropical Japonica	504	13.90%	0.80%	16.67%	68.65%	NA
Japonica Intermediate	241	70.10%	2.50%	4.15%	23.24%	NA
VI/Aromatic	96	35.40%	0.00%	47.92%	16.67%	NA
Intermediate	90	45.60%	0.00%	26.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215881109	C -> DEL	LOC_Os12g27096.1	N	frameshift_variant	Average:12.475; most accessible tissue: Callus, score: 20.94	N	N	N	N
vg1215881109	C -> T	LOC_Os12g27096.1	synonymous_variant ; p.Leu1722Leu; LOW	synonymous_codon	Average:12.475; most accessible tissue: Callus, score: 20.94	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215881109	NA	7.13E-06	mr1623	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	7.31E-06	7.31E-06	mr1054_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	6.01E-06	6.01E-06	mr1081_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	7.12E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	1.16E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	2.03E-06	2.03E-06	mr1285_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	7.63E-07	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	5.51E-06	5.51E-06	mr1351_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	1.57E-06	1.57E-06	mr1357_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	6.67E-06	mr1381_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	1.40E-06	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	2.97E-06	2.97E-06	mr1413_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	4.60E-06	4.60E-06	mr1432_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	7.28E-06	mr1482_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	6.86E-06	6.86E-06	mr1516_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	1.63E-06	mr1545_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	2.85E-06	2.85E-06	mr1592_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	8.41E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	1.93E-06	mr1713_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	3.59E-07	mr1735_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	6.30E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	2.21E-06	2.21E-06	mr1785_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	8.97E-06	mr1874_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	NA	6.40E-06	mr1891_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	3.18E-06	3.18E-06	mr1941_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215881109	9.63E-06	9.63E-06	mr1953_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251