\
| Variant ID: vg1215874878 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15874878 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTTCAAGGTGGAATTTTTTCCATCCGAATTTGTCTTGCCCATCTGCTTACCCATCTTGCCTATATGGACGTGACTAGGTAGAGTGCGGGTTCAGATCTC[C/G]
TGGAGTTGTGGACGACCCCACCAGGTGGATTTGGCCAAATATAGACCCTCCTTTTCTTCTACGGCTGAGATCATATCTCTTAATAATTATTATAAAAAAA
TTTTTTTATAATAATTATTAAGAGATATGATCTCAGCCGTAGAAGAAAAGGAGGGTCTATATTTGGCCAAATCCACCTGGTGGGGTCGTCCACAACTCCA[G/C]
GAGATCTGAACCCGCACTCTACCTAGTCACGTCCATATAGGCAAGATGGGTAAGCAGATGGGCAAGACAAATTCGGATGGAAAAAATTCCACCTTGAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 0.70% | 0.55% | 9.29% | NA |
| All Indica | 2759 | 93.10% | 0.10% | 0.22% | 6.56% | NA |
| All Japonica | 1512 | 85.00% | 1.90% | 1.06% | 12.04% | NA |
| Aus | 269 | 72.90% | 0.00% | 1.49% | 25.65% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.40% | 0.00% | 0.22% | 25.38% | NA |
| Indica III | 913 | 97.30% | 0.00% | 0.22% | 2.52% | NA |
| Indica Intermediate | 786 | 94.50% | 0.00% | 0.38% | 5.09% | NA |
| Temperate Japonica | 767 | 95.30% | 2.60% | 1.83% | 0.26% | NA |
| Tropical Japonica | 504 | 66.50% | 0.60% | 0.40% | 32.54% | NA |
| Japonica Intermediate | 241 | 90.90% | 2.50% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215874878 | C -> DEL | N | N | silent_mutation | Average:30.462; most accessible tissue: Zhenshan97 flower, score: 69.437 | N | N | N | N |
| vg1215874878 | C -> G | LOC_Os12g27090-LOC_Os12g27096 | intergenic_region ; MODIFIER | silent_mutation | Average:30.462; most accessible tissue: Zhenshan97 flower, score: 69.437 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215874878 | 9.19E-07 | 9.19E-07 | mr1915 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | 1.74E-06 | 1.74E-06 | mr1081_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | NA | 2.08E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | NA | 4.88E-06 | mr1148_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | NA | 6.38E-06 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | NA | 5.32E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | NA | 8.74E-06 | mr1482_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215874878 | NA | 1.45E-06 | mr1735_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |