Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215829261:

Variant ID: vg1215829261 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 15829261
Reference Allele: GT	Alternative Allele: AT,G
Primary Allele: GT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTAGGGTTCCACCATATATATACCTCTTGTAAGCCGCCGTGCAGCGATGTAACCTCACCCTAGATATAGTGAAGATATTTTGCTGGCTAGCGCCCGTG[GT/AT,G]
TTTTTTCTCTCCTGCTTTGGGAGGGTTTTCCACGTTAAAATCTCGTGTCTTCTGTGATTGATCTATTGTTCTTTATCGTTTGTTTGCCTATCGTTTCCTA

Reverse complement sequence

TAGGAAACGATAGGCAAACAAACGATAAAGAACAATAGATCAATCACAGAAGACACGAGATTTTAACGTGGAAAACCCTCCCAAAGCAGGAGAGAAAAAA[AC/AT,C]
CACGGGCGCTAGCCAGCAAAATATCTTCACTATATCTAGGGTGAGGTTACATCGCTGCACGGCGGCTTACAAGAGGTATATATATGGTGGAACCCTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	3.50%	1.42%	0.00%	G: 0.13%
All Indica	2759	99.30%	0.30%	0.22%	0.00%	G: 0.22%
All Japonica	1512	87.00%	9.30%	3.77%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.80%	0.00%	0.00%	0.00%	G: 0.22%
Indica Intermediate	786	98.30%	0.60%	0.51%	0.00%	G: 0.51%
Temperate Japonica	767	91.80%	3.90%	4.30%	0.00%	NA
Tropical Japonica	504	89.10%	9.70%	1.19%	0.00%	NA
Japonica Intermediate	241	67.20%	25.30%	7.47%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	3.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215829261	GT -> AT	LOC_Os12g27040.1	upstream_gene_variant ; 4692.0bp to feature; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> AT	LOC_Os12g27025.1	downstream_gene_variant ; 429.0bp to feature; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> AT	LOC_Os12g27030.1	downstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> AT	LOC_Os12g27025-LOC_Os12g27030	intergenic_region ; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> G	LOC_Os12g27040.1	upstream_gene_variant ; 4691.0bp to feature; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> G	LOC_Os12g27025.1	downstream_gene_variant ; 430.0bp to feature; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> G	LOC_Os12g27030.1	downstream_gene_variant ; 335.0bp to feature; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1215829261	GT -> G	LOC_Os12g27025-LOC_Os12g27030	intergenic_region ; MODIFIER	silent_mutation	Average:59.269; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215829261	NA	4.71E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	6.62E-06	mr1931	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	7.73E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	4.87E-06	mr1298_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	3.68E-08	mr1318_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	9.16E-06	9.16E-06	mr1357_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	6.49E-06	mr1381_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	1.62E-06	1.62E-06	mr1432_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	8.13E-06	mr1545_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	3.84E-06	3.83E-06	mr1592_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	1.80E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	1.23E-07	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	4.63E-06	mr1713_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	8.53E-06	mr1731_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	6.47E-07	6.47E-07	mr1777_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215829261	NA	1.55E-07	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251