Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215825879:

Variant ID: vg1215825879 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15825879
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAACCCTCCTATAGTCCCGGTTTTTAAACCGGGACTATGAATCCGGGACTAAAGATCCCTATCTTTAGTCCCCGTTCAAATACCTAGGACTACCAACC[G/A]
GGACTAAAGATGGGAGTGGGCAATAGTTTTTTTTTCATTTATTTACTATTTAATCTCTAATTTATTTTCTCCCAAATTAGGTGGGATGCATATTCCTAAA

Reverse complement sequence

TTTAGGAATATGCATCCCACCTAATTTGGGAGAAAATAAATTAGAGATTAAATAGTAAATAAATGAAAAAAAAACTATTGCCCACTCCCATCTTTAGTCC[C/T]
GGTTGGTAGTCCTAGGTATTTGAACGGGGACTAAAGATAGGGATCTTTAGTCCCGGATTCATAGTCCCGGTTTAAAAACCGGGACTATAGGAGGGTTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.80% 0.02% 0.00% NA
All Indica  2759 94.90% 5.10% 0.04% 0.00% NA
All Japonica  1512 91.80% 8.20% 0.00% 0.00% NA
Aus  269 50.20% 49.80% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 93.60% 6.20% 0.11% 0.00% NA
Indica Intermediate  786 94.70% 5.30% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 82.30% 17.70% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215825879 G -> A LOC_Os12g27025.1 upstream_gene_variant ; 2672.0bp to feature; MODIFIER silent_mutation Average:34.568; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1215825879 G -> A LOC_Os12g27020.1 downstream_gene_variant ; 2058.0bp to feature; MODIFIER silent_mutation Average:34.568; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1215825879 G -> A LOC_Os12g27030.1 downstream_gene_variant ; 3718.0bp to feature; MODIFIER silent_mutation Average:34.568; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1215825879 G -> A LOC_Os12g27020-LOC_Os12g27025 intergenic_region ; MODIFIER silent_mutation Average:34.568; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215825879 2.28E-08 2.03E-15 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.49E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 3.76E-07 1.94E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.72E-08 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 8.81E-08 7.15E-15 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.46E-08 NA mr1019 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.82E-07 1.37E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 1.51E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 4.62E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 3.71E-09 3.30E-17 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 3.68E-06 2.21E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.09E-06 6.02E-15 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 8.78E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 6.57E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 2.01E-08 2.46E-17 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 3.39E-08 5.01E-17 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 3.09E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 8.47E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 2.24E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 5.27E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 8.26E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.04E-06 5.90E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 1.34E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 7.87E-08 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 2.62E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 2.21E-10 1.63E-17 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 4.89E-07 7.99E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 5.54E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 1.31E-11 8.27E-22 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 8.78E-09 7.86E-19 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 NA 5.10E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 2.27E-12 9.21E-22 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 3.91E-07 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215825879 2.09E-12 5.59E-22 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251