\
| Variant ID: vg1215809668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15809668 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 218. )
GCTCCAGTTATCTTTTTATTTTCCGCTGCATTTATGTAATACTTTTATAATGTTTGTAAGACGTGGATCTGTATGTCAAATTTGTCGTTTGTGTACCCCG[A/G]
CCGGTCCTGGACGGGGGTTTTAATGCACATTCTGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACACCTCATCTCAATCGGGCATTTAGTTATGGCC
GGCCATAACTAAATGCCCGATTGAGATGAGGTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCAGAATGTGCATTAAAACCCCCGTCCAGGACCGG[T/C]
CGGGGTACACAAACGACAAATTTGACATACAGATCCACGTCTTACAAACATTATAAAAGTATTACATAAATGCAGCGGAAAATAAAAAGATAACTGGAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 36.20% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 43.60% | 56.20% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 96.20% | 3.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 66.90% | 33.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 32.50% | 67.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 29.20% | 70.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 45.50% | 54.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 11.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215809668 | A -> G | LOC_Os12g26980.1 | downstream_gene_variant ; 4598.0bp to feature; MODIFIER | silent_mutation | Average:33.985; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg1215809668 | A -> G | LOC_Os12g26990.1 | downstream_gene_variant ; 450.0bp to feature; MODIFIER | silent_mutation | Average:33.985; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg1215809668 | A -> G | LOC_Os12g27000.1 | downstream_gene_variant ; 2442.0bp to feature; MODIFIER | silent_mutation | Average:33.985; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg1215809668 | A -> G | LOC_Os12g26980-LOC_Os12g26990 | intergenic_region ; MODIFIER | silent_mutation | Average:33.985; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215809668 | 4.69E-08 | NA | mr1022 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | 1.65E-07 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | 1.00E-07 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | 2.55E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | 3.44E-07 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | NA | 5.27E-10 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | NA | 1.61E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215809668 | 3.05E-07 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |