\
| Variant ID: vg1215802194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15802194 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )
CTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCAC[G/A]
CCATTATACTATGGCGCAAGCGATACATCATCCTCCCAGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCC
GGAGCCTGAGGAGGAGATGGCGGAGCCGGAGGAGATGGTGCACGAGACGCCGCTTGTCGCCCTGGGAGGATGATGTATCGCTTGCGCCATAGTATAATGG[C/T]
GTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAATCCAACTCGAGGTCCTCGTACGCGCCTTCGACCAACTCAACTTCGACCTTGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 23.00% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 61.90% | 37.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.60% | 28.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 37.10% | 62.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 64.90% | 35.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215802194 | G -> A | LOC_Os12g26980.1 | upstream_gene_variant ; 2592.0bp to feature; MODIFIER | silent_mutation | Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg1215802194 | G -> A | LOC_Os12g26970.1 | downstream_gene_variant ; 4001.0bp to feature; MODIFIER | silent_mutation | Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg1215802194 | G -> A | LOC_Os12g26970-LOC_Os12g26980 | intergenic_region ; MODIFIER | silent_mutation | Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215802194 | NA | 8.76E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 9.18E-06 | mr1282 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | 5.08E-06 | 5.08E-06 | mr1282_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 7.13E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 1.30E-08 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 4.37E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 5.69E-06 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 5.70E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215802194 | NA | 4.38E-06 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |