\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215802194:

Variant ID: vg1215802194 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15802194
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCAC[G/A]
CCATTATACTATGGCGCAAGCGATACATCATCCTCCCAGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCC

Reverse complement sequence

GGAGCCTGAGGAGGAGATGGCGGAGCCGGAGGAGATGGTGCACGAGACGCCGCTTGTCGCCCTGGGAGGATGATGTATCGCTTGCGCCATAGTATAATGG[C/T]
GTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAATCCAACTCGAGGTCCTCGTACGCGCCTTCGACCAACTCAACTTCGACCTTGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 23.00% 0.11% 0.00% NA
All Indica  2759 61.90% 37.90% 0.14% 0.00% NA
All Japonica  1512 98.30% 1.60% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 71.60% 28.10% 0.34% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 37.10% 62.80% 0.11% 0.00% NA
Indica Intermediate  786 64.90% 35.00% 0.13% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215802194 G -> A LOC_Os12g26980.1 upstream_gene_variant ; 2592.0bp to feature; MODIFIER silent_mutation Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg1215802194 G -> A LOC_Os12g26970.1 downstream_gene_variant ; 4001.0bp to feature; MODIFIER silent_mutation Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg1215802194 G -> A LOC_Os12g26970-LOC_Os12g26980 intergenic_region ; MODIFIER silent_mutation Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215802194 NA 8.76E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 9.18E-06 mr1282 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 5.08E-06 5.08E-06 mr1282_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 7.13E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 1.30E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 4.37E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 5.69E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 5.70E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194 NA 4.38E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251