\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215801176:

Variant ID: vg1215801176 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15801176
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCACATAAGACATGTGAACAAG[G/A]
GCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAG

Reverse complement sequence

CTCCCACTTCGGCATCGCGACGCTATAGCCTCCTGACCCCAAGTGGTGATGGTACTTCTTCTTGGCGGCATTTTCTTTGTTTCTTTCCATCATCGCCTGC[C/T]
CTTGTTCACATGTCTTATGTGCAACGAACTCGTCCCAGTGATCCCTTAGCTTTGGGAATGTGTCGAAGTTCGGTGTCTGCCCCTTCAGGATATATTTCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 42.30% 3.68% 2.60% NA
All Indica  2759 44.60% 48.40% 5.36% 1.70% NA
All Japonica  1512 71.30% 28.00% 0.60% 0.07% NA
Aus  269 10.40% 58.00% 4.09% 27.51% NA
Indica I  595 32.10% 66.70% 1.18% 0.00% NA
Indica II  465 15.70% 59.60% 18.71% 6.02% NA
Indica III  913 68.10% 30.20% 1.10% 0.55% NA
Indica Intermediate  786 43.80% 48.90% 5.60% 1.78% NA
Temperate Japonica  767 92.80% 7.20% 0.00% 0.00% NA
Tropical Japonica  504 37.10% 61.50% 1.39% 0.00% NA
Japonica Intermediate  241 74.30% 24.50% 0.83% 0.41% NA
VI/Aromatic  96 35.40% 60.40% 3.12% 1.04% NA
Intermediate  90 65.60% 31.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215801176 G -> DEL N N silent_mutation Average:21.374; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1215801176 G -> A LOC_Os12g26980.1 upstream_gene_variant ; 3610.0bp to feature; MODIFIER silent_mutation Average:21.374; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1215801176 G -> A LOC_Os12g26970.1 downstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:21.374; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg1215801176 G -> A LOC_Os12g26970-LOC_Os12g26980 intergenic_region ; MODIFIER silent_mutation Average:21.374; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215801176 2.02E-08 6.79E-21 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 6.15E-06 1.59E-18 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.31E-06 1.84E-17 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.72E-07 1.61E-16 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 1.10E-12 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 8.00E-06 1.78E-19 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.51E-07 9.32E-21 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 4.12E-07 1.92E-21 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 2.19E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 3.55E-09 6.96E-23 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 2.04E-07 9.69E-22 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 3.66E-16 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 2.85E-08 mr1257 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 2.30E-09 1.02E-23 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 1.63E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 8.97E-08 1.34E-20 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 8.78E-10 1.44E-24 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.11E-06 4.30E-20 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.53E-08 1.68E-20 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 7.67E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 2.92E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 3.46E-07 5.98E-16 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.49E-06 2.60E-17 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 3.12E-10 6.37E-30 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 2.30E-07 1.69E-18 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 6.05E-09 5.58E-27 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 3.43E-08 3.88E-26 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 7.70E-08 1.15E-23 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 9.61E-11 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 1.32E-08 2.42E-24 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 3.83E-07 6.38E-25 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 2.20E-09 6.89E-26 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215801176 NA 3.97E-20 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251