\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215783850:

Variant ID: vg1215783850 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15783850
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCAGCGTTGAAGTCGGAGTCAGCGTTGGAGGCAGCGGTGGCGGCGGCGCAGGTGGAGGGAAGCGGCGGAGCGAGCGGGAGCGGGGAGGGTAGCGCCGA[C/T]
AAGTGGCGTGGGGAGGCAGAGGGAAGAGGCGCGCGGCGTGAGGAGCGCGGCGCAGGCGGAGAGAAGCGGCCGAGAAAGCGGTGGTTTGTGGGTTTTCTCG

Reverse complement sequence

CGAGAAAACCCACAAACCACCGCTTTCTCGGCCGCTTCTCTCCGCCTGCGCCGCGCTCCTCACGCCGCGCGCCTCTTCCCTCTGCCTCCCCACGCCACTT[G/A]
TCGGCGCTACCCTCCCCGCTCCCGCTCGCTCCGCCGCTTCCCTCCACCTGCGCCGCCGCCACCGCTGCCTCCAACGCTGACTCCGACTTCAACGCTGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.60% 0.02% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 80.10% 19.80% 0.07% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 54.80% 45.20% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.00% 0.41% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215783850 C -> T LOC_Os12g26950.1 upstream_gene_variant ; 540.0bp to feature; MODIFIER silent_mutation Average:74.087; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg1215783850 C -> T LOC_Os12g26960.1 upstream_gene_variant ; 4711.0bp to feature; MODIFIER silent_mutation Average:74.087; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg1215783850 C -> T LOC_Os12g26940.1 downstream_gene_variant ; 3926.0bp to feature; MODIFIER silent_mutation Average:74.087; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N
vg1215783850 C -> T LOC_Os12g26950-LOC_Os12g26960 intergenic_region ; MODIFIER silent_mutation Average:74.087; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215783850 8.05E-07 NA mr1051_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215783850 NA 1.29E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215783850 NA 2.43E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251