\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215769622:

Variant ID: vg1215769622 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15769622
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCGAAGGAGAGGGGGACTAGGGCTCCATTTTATAGGCAATGGAGGGGAGTGCCGACCACAGGAGGGGACGGGAACGACGCCGGAGAACGTGGCCAGC[G/A]
GCATCAATGGCGGTCAAAGAAGAGGGATTAAATCCCGGTGATTGGGGGCGGGATTAAAGGTGGAAAGTTGGGGGTAATAATGAGGAAGGGATGGGGATTC

Reverse complement sequence

GAATCCCCATCCCTTCCTCATTATTACCCCCAACTTTCCACCTTTAATCCCGCCCCCAATCACCGGGATTTAATCCCTCTTCTTTGACCGCCATTGATGC[C/T]
GCTGGCCACGTTCTCCGGCGTCGTTCCCGTCCCCTCCTGTGGTCGGCACTCCCCTCCATTGCCTATAAAATGGAGCCCTAGTCCCCCTCTCCTTCGGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 32.90% 0.53% 4.13% NA
All Indica  2759 50.90% 44.40% 0.47% 4.31% NA
All Japonica  1512 90.10% 9.40% 0.26% 0.20% NA
Aus  269 19.30% 52.40% 1.49% 26.77% NA
Indica I  595 23.20% 76.10% 0.67% 0.00% NA
Indica II  465 65.40% 17.40% 0.00% 17.20% NA
Indica III  913 63.10% 35.70% 0.33% 0.88% NA
Indica Intermediate  786 49.00% 46.30% 0.76% 3.94% NA
Temperate Japonica  767 97.00% 2.70% 0.26% 0.00% NA
Tropical Japonica  504 79.60% 19.80% 0.40% 0.20% NA
Japonica Intermediate  241 90.50% 8.70% 0.00% 0.83% NA
VI/Aromatic  96 72.90% 24.00% 2.08% 1.04% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215769622 G -> DEL N N silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1215769622 G -> A LOC_Os12g26890.1 upstream_gene_variant ; 4968.0bp to feature; MODIFIER silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1215769622 G -> A LOC_Os12g26900.1 upstream_gene_variant ; 2122.0bp to feature; MODIFIER silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1215769622 G -> A LOC_Os12g26910.1 downstream_gene_variant ; 78.0bp to feature; MODIFIER silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1215769622 G -> A LOC_Os12g26920.1 downstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1215769622 G -> A LOC_Os12g26930.1 downstream_gene_variant ; 3048.0bp to feature; MODIFIER silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1215769622 G -> A LOC_Os12g26910-LOC_Os12g26920 intergenic_region ; MODIFIER silent_mutation Average:64.394; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215769622 2.28E-08 2.03E-15 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.76E-07 1.94E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 8.81E-08 7.15E-15 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 1.82E-07 1.37E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 1.51E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.71E-09 3.30E-17 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.68E-06 2.21E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 1.09E-06 6.02E-15 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 8.78E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 6.57E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 6.22E-06 mr1330 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 2.01E-08 2.46E-17 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.39E-08 5.01E-17 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.09E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.47E-06 6.82E-09 mr1659 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 2.24E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 5.27E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 1.04E-06 5.90E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 1.34E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 7.87E-08 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 2.21E-10 1.63E-17 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 4.89E-07 7.99E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 1.31E-11 8.27E-22 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 8.78E-09 7.86E-19 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 5.10E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 2.27E-12 9.21E-22 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 3.91E-07 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 2.09E-12 5.59E-22 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215769622 NA 1.23E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251