Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215727563:

Variant ID: vg1215727563 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15727563
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GAACCGGAACGCCTGCCCGGGAGGGAAGGCGAAGTCGTCGATGCCAGAAACGGAACCCATCGCACTTAGTCGGCAAAAACTTGACGCTGCCCCTACCTGG[T/C,A]
GCGCCAACTGTCGAAACAAAATTTCGGCAATACAAAAAGAGGGTGACTGTCAAGCTAGGAAAGTGGATGGGTTTGGAGACGAAGAATTTTATACAGGTTC

Reverse complement sequence

GAACCTGTATAAAATTCTTCGTCTCCAAACCCATCCACTTTCCTAGCTTGACAGTCACCCTCTTTTTGTATTGCCGAAATTTTGTTTCGACAGTTGGCGC[A/G,T]
CCAGGTAGGGGCAGCGTCAAGTTTTTGCCGACTAAGTGCGATGGGTTCCGTTTCTGGCATCGACGACTTCGCCTTCCCTCCCGGGCAGGCGTTCCGGTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	22.40%	4.72%	3.81%	A: 0.08%
All Indica	2759	67.50%	18.50%	7.54%	6.42%	A: 0.07%
All Japonica	1512	70.50%	29.00%	0.33%	0.13%	NA
Aus	269	88.10%	9.70%	1.49%	0.00%	A: 0.74%
Indica I	595	90.10%	3.70%	3.87%	2.35%	NA
Indica II	465	76.80%	13.50%	6.02%	3.66%	NA
Indica III	913	43.40%	33.00%	11.50%	12.16%	NA
Indica Intermediate	786	72.90%	15.80%	6.62%	4.45%	A: 0.25%
Temperate Japonica	767	95.60%	4.00%	0.13%	0.26%	NA
Tropical Japonica	504	31.30%	68.10%	0.60%	0.00%	NA
Japonica Intermediate	241	72.60%	27.00%	0.41%	0.00%	NA
VI/Aromatic	96	39.60%	60.40%	0.00%	0.00%	NA
Intermediate	90	62.20%	30.00%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215727563	T -> C	LOC_Os12g26830.1	upstream_gene_variant ; 4594.0bp to feature; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> C	LOC_Os12g26840.1	upstream_gene_variant ; 41.0bp to feature; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> C	LOC_Os12g26850.1	downstream_gene_variant ; 992.0bp to feature; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> C	LOC_Os12g26840-LOC_Os12g26850	intergenic_region ; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> DEL	N	N	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> A	LOC_Os12g26830.1	upstream_gene_variant ; 4594.0bp to feature; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> A	LOC_Os12g26840.1	upstream_gene_variant ; 41.0bp to feature; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> A	LOC_Os12g26850.1	downstream_gene_variant ; 992.0bp to feature; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg1215727563	T -> A	LOC_Os12g26840-LOC_Os12g26850	intergenic_region ; MODIFIER	silent_mutation	Average:49.386; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215727563	4.31E-06	4.31E-06	mr1564	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215727563	NA	4.44E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251