\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215690354:

Variant ID: vg1215690354 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15690354
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGGTGCATGCATTGAAGATTTGGCGTCATTATCTTTTCGGTGACCGTACAGAGATGTATACGGATCATAAAAGTTTGAAGTACATTTTCACTCAACCT[A/G]
ATTTGAACATGCGTCAGCGAAGATGGTTAGAATTGATTAAAGACTATGATATGGAAATCCACTATCACCCGGGGAAAGCAAATGTTGTAGCCGATGCTCT

Reverse complement sequence

AGAGCATCGGCTACAACATTTGCTTTCCCCGGGTGATAGTGGATTTCCATATCATAGTCTTTAATCAATTCTAACCATCTTCGCTGACGCATGTTCAAAT[T/C]
AGGTTGAGTGAAAATGTACTTCAAACTTTTATGATCCGTATACATCTCTGTACGGTCACCGAAAAGATAATGACGCCAAATCTTCAATGCATGCACCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.90% 2.70% 12.38% 4.97% NA
All Indica  2759 82.00% 3.00% 14.90% 0.07% NA
All Japonica  1512 80.60% 0.90% 3.51% 15.01% NA
Aus  269 61.30% 8.90% 28.25% 1.49% NA
Indica I  595 77.00% 2.70% 20.34% 0.00% NA
Indica II  465 81.90% 3.00% 14.62% 0.43% NA
Indica III  913 84.70% 3.00% 12.38% 0.00% NA
Indica Intermediate  786 82.70% 3.40% 13.87% 0.00% NA
Temperate Japonica  767 94.90% 0.50% 1.17% 3.39% NA
Tropical Japonica  504 59.90% 1.00% 6.75% 32.34% NA
Japonica Intermediate  241 78.00% 2.10% 4.15% 15.77% NA
VI/Aromatic  96 56.20% 5.20% 38.54% 0.00% NA
Intermediate  90 87.80% 1.10% 8.89% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215690354 A -> DEL LOC_Os12g26780.1 N frameshift_variant Average:14.597; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 N N N N
vg1215690354 A -> G LOC_Os12g26780.1 missense_variant ; p.Asn907Asp; MODERATE nonsynonymous_codon Average:14.597; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 benign -0.329 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215690354 NA 1.74E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 7.29E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 8.35E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.27E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.03E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 3.70E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.03E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 2.32E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.27E-10 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 2.20E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 9.37E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.15E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.87E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 3.36E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 3.59E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.15E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 1.41E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 5.28E-07 NA mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354 NA 4.06E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251