Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215690354:

Variant ID: vg1215690354 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15690354
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGGTGCATGCATTGAAGATTTGGCGTCATTATCTTTTCGGTGACCGTACAGAGATGTATACGGATCATAAAAGTTTGAAGTACATTTTCACTCAACCT[A/G]
ATTTGAACATGCGTCAGCGAAGATGGTTAGAATTGATTAAAGACTATGATATGGAAATCCACTATCACCCGGGGAAAGCAAATGTTGTAGCCGATGCTCT

Reverse complement sequence

AGAGCATCGGCTACAACATTTGCTTTCCCCGGGTGATAGTGGATTTCCATATCATAGTCTTTAATCAATTCTAACCATCTTCGCTGACGCATGTTCAAAT[T/C]
AGGTTGAGTGAAAATGTACTTCAAACTTTTATGATCCGTATACATCTCTGTACGGTCACCGAAAAGATAATGACGCCAAATCTTCAATGCATGCACCACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	2.70%	12.38%	4.97%	NA
All Indica	2759	82.00%	3.00%	14.90%	0.07%	NA
All Japonica	1512	80.60%	0.90%	3.51%	15.01%	NA
Aus	269	61.30%	8.90%	28.25%	1.49%	NA
Indica I	595	77.00%	2.70%	20.34%	0.00%	NA
Indica II	465	81.90%	3.00%	14.62%	0.43%	NA
Indica III	913	84.70%	3.00%	12.38%	0.00%	NA
Indica Intermediate	786	82.70%	3.40%	13.87%	0.00%	NA
Temperate Japonica	767	94.90%	0.50%	1.17%	3.39%	NA
Tropical Japonica	504	59.90%	1.00%	6.75%	32.34%	NA
Japonica Intermediate	241	78.00%	2.10%	4.15%	15.77%	NA
VI/Aromatic	96	56.20%	5.20%	38.54%	0.00%	NA
Intermediate	90	87.80%	1.10%	8.89%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215690354	A -> DEL	LOC_Os12g26780.1	N	frameshift_variant	Average:14.597; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	N	N	N	N
vg1215690354	A -> G	LOC_Os12g26780.1	missense_variant ; p.Asn907Asp; MODERATE	nonsynonymous_codon	Average:14.597; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	benign	-0.329	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215690354	NA	1.74E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	7.29E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	8.35E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.27E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.03E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	3.70E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.03E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	2.32E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.27E-10	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	2.20E-08	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	9.37E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.15E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.87E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	3.36E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	3.59E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.15E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	1.41E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	5.28E-07	NA	mr1966_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215690354	NA	4.06E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251