Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215673774:

Variant ID: vg1215673774 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15673774
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCACAAAAATCTTTAAATATTCCGCCCGTAAATTGAGTGCCGTTATCCGTAATGATATGATTCGGTACTCCAAACCGATATACAATATTGATGAAGAAAT[C/A]
TCTAGCTTTGTCTATGGTGATTGTGACGACCGGTTTGGCTTCAATCCACTTGGAAAACTTTTCCACAGCTACAAAGAGATGAGTATAACCCCCGACTGCC

Reverse complement sequence

GGCAGTCGGGGGTTATACTCATCTCTTTGTAGCTGTGGAAAAGTTTTCCAAGTGGATTGAAGCCAAACCGGTCGTCACAATCACCATAGACAAAGCTAGA[G/T]
ATTTCTTCATCAATATTGTATATCGGTTTGGAGTACCGAATCATATCATTACGGATAACGGCACTCAATTTACGGGCGGAATATTTAAAGATTTTTGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 28.00% 2.81% 0.97% NA
All Indica  2759 57.20% 36.80% 4.39% 1.63% NA
All Japonica  1512 90.50% 9.30% 0.13% 0.07% NA
Aus  269 52.00% 45.00% 2.97% 0.00% NA
Indica I  595 27.20% 65.90% 6.89% 0.00% NA
Indica II  465 70.30% 17.00% 4.30% 8.39% NA
Indica III  913 70.90% 26.20% 2.96% 0.00% NA
Indica Intermediate  786 56.20% 38.80% 4.20% 0.76% NA
Temperate Japonica  767 97.10% 2.70% 0.00% 0.13% NA
Tropical Japonica  504 80.00% 19.60% 0.40% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215673774 C -> DEL N N silent_mutation Average:23.654; most accessible tissue: Callus, score: 44.286 N N N N
vg1215673774 C -> A LOC_Os12g26740.1 downstream_gene_variant ; 1022.0bp to feature; MODIFIER silent_mutation Average:23.654; most accessible tissue: Callus, score: 44.286 N N N N
vg1215673774 C -> A LOC_Os12g26750.1 downstream_gene_variant ; 223.0bp to feature; MODIFIER silent_mutation Average:23.654; most accessible tissue: Callus, score: 44.286 N N N N
vg1215673774 C -> A LOC_Os12g26740-LOC_Os12g26750 intergenic_region ; MODIFIER silent_mutation Average:23.654; most accessible tissue: Callus, score: 44.286 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215673774 2.28E-08 2.03E-15 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.76E-07 1.94E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 8.81E-08 7.15E-15 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 1.82E-07 1.37E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 1.51E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.71E-09 3.30E-17 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.68E-06 2.21E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 1.09E-06 6.02E-15 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 8.78E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 2.84E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 6.57E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.66E-07 NA mr1323 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 2.01E-08 2.46E-17 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 3.55E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 4.65E-06 mr1438 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.39E-08 5.01E-17 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.09E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 8.96E-06 2.73E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 9.61E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 2.47E-07 mr1659 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 4.76E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 9.16E-07 2.24E-12 mr1790 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 2.24E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 1.80E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 5.27E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 4.06E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 1.04E-06 5.90E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 1.34E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 7.87E-08 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 2.21E-10 1.63E-17 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 4.89E-07 7.99E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 1.31E-11 8.27E-22 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 8.78E-09 7.86E-19 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 NA 5.10E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 2.27E-12 9.21E-22 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 3.91E-07 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215673774 2.09E-12 5.59E-22 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251