\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215670841:

Variant ID: vg1215670841 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15670841
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTTTTCACAAAATATAGTCTTGTCTTTTTGTTGAATCATTTAACAATGAAGGATATCATGCCTAGGAATTTGCTTTGATGAAATCGGACCCCCCAGT[C/T]
GTTCAACGCCGATCACCCCATCGCCAAACCGGTCAAGGGAGCGGGGGTCCCAAGATCCATTCTGAAGCCCGGCTAAATACTTCATATCCAGCCGGCCAGC

Reverse complement sequence

GCTGGCCGGCTGGATATGAAGTATTTAGCCGGGCTTCAGAATGGATCTTGGGACCCCCGCTCCCTTGACCGGTTTGGCGATGGGGTGATCGGCGTTGAAC[G/A]
ACTGGGGGGTCCGATTTCATCAAAGCAAATTCCTAGGCATGATATCCTTCATTGTTAAATGATTCAACAAAAAGACAAGACTATATTTTGTGAAAAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 3.20% 2.45% 0.15% NA
All Indica  2759 95.00% 0.60% 4.13% 0.25% NA
All Japonica  1512 91.70% 8.20% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 85.20% 0.20% 13.33% 1.29% NA
Indica III  913 98.60% 0.50% 0.77% 0.11% NA
Indica Intermediate  786 93.40% 1.00% 5.60% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 76.40% 23.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215670841 C -> DEL N N silent_mutation Average:28.574; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1215670841 C -> T LOC_Os12g26750.1 downstream_gene_variant ; 3156.0bp to feature; MODIFIER silent_mutation Average:28.574; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1215670841 C -> T LOC_Os12g26740.1 intron_variant ; MODIFIER silent_mutation Average:28.574; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215670841 9.09E-07 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 2.28E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 8.87E-06 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 5.16E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 7.32E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 1.03E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 7.34E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 3.36E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 8.78E-06 mr1835 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 1.18E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 1.38E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 8.90E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 3.08E-07 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 1.16E-06 NA mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 NA 2.31E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 7.69E-08 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215670841 5.42E-08 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251