\
| Variant ID: vg1215670841 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15670841 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 227. )
CATCTTTTCACAAAATATAGTCTTGTCTTTTTGTTGAATCATTTAACAATGAAGGATATCATGCCTAGGAATTTGCTTTGATGAAATCGGACCCCCCAGT[C/T]
GTTCAACGCCGATCACCCCATCGCCAAACCGGTCAAGGGAGCGGGGGTCCCAAGATCCATTCTGAAGCCCGGCTAAATACTTCATATCCAGCCGGCCAGC
GCTGGCCGGCTGGATATGAAGTATTTAGCCGGGCTTCAGAATGGATCTTGGGACCCCCGCTCCCTTGACCGGTTTGGCGATGGGGTGATCGGCGTTGAAC[G/A]
ACTGGGGGGTCCGATTTCATCAAAGCAAATTCCTAGGCATGATATCCTTCATTGTTAAATGATTCAACAAAAAGACAAGACTATATTTTGTGAAAAGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 3.20% | 2.45% | 0.15% | NA |
| All Indica | 2759 | 95.00% | 0.60% | 4.13% | 0.25% | NA |
| All Japonica | 1512 | 91.70% | 8.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 85.20% | 0.20% | 13.33% | 1.29% | NA |
| Indica III | 913 | 98.60% | 0.50% | 0.77% | 0.11% | NA |
| Indica Intermediate | 786 | 93.40% | 1.00% | 5.60% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215670841 | C -> DEL | N | N | silent_mutation | Average:28.574; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg1215670841 | C -> T | LOC_Os12g26750.1 | downstream_gene_variant ; 3156.0bp to feature; MODIFIER | silent_mutation | Average:28.574; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg1215670841 | C -> T | LOC_Os12g26740.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.574; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215670841 | 9.09E-07 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 2.28E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | 8.87E-06 | NA | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 5.16E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 7.32E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 1.03E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 7.34E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 3.36E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 8.78E-06 | mr1835 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | 1.18E-07 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 1.38E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 8.90E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | 3.08E-07 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | 1.16E-06 | NA | mr1178_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | NA | 2.31E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | 7.69E-08 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215670841 | 5.42E-08 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |