Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215669490:

Variant ID: vg1215669490 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15669490
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTCTGTCGGACACCTTTTTATTTGCATCATAATAATTCCAAAGAATTATTAAACCGCGTTAAAAAGGATTTTAGCAGCATCGGGCCACATCATTGTG[A/T]
GTACAAATTGCCAAAGCAAAAAGCACCTAAGTCCCTAGGGATCACAACCGGCCACGCTGATTATAATATTGGGCTGAAGTACTGTACAGGCCCAGGACCA

Reverse complement sequence

TGGTCCTGGGCCTGTACAGTACTTCAGCCCAATATTATAATCAGCGTGGCCGGTTGTGATCCCTAGGGACTTAGGTGCTTTTTGCTTTGGCAATTTGTAC[T/A]
CACAATGATGTGGCCCGATGCTGCTAAAATCCTTTTTAACGCGGTTTAATAATTCTTTGGAATTATTATGATGCAAATAAAAAGGTGTCCGACAGAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	26.10%	6.58%	1.14%	NA
All Indica	2759	57.90%	29.10%	11.05%	1.88%	NA
All Japonica	1512	77.70%	22.00%	0.26%	0.07%	NA
Aus	269	91.80%	7.80%	0.37%	0.00%	NA
Indica I	595	90.90%	8.40%	0.67%	0.00%	NA
Indica II	465	44.70%	15.70%	29.46%	10.11%	NA
Indica III	913	38.00%	54.10%	7.89%	0.00%	NA
Indica Intermediate	786	63.90%	23.80%	11.70%	0.64%	NA
Temperate Japonica	767	94.50%	5.10%	0.26%	0.13%	NA
Tropical Japonica	504	55.00%	45.00%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	27.40%	0.83%	0.00%	NA
VI/Aromatic	96	40.60%	59.40%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215669490	A -> DEL	N	N	silent_mutation	Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg1215669490	A -> T	LOC_Os12g26740.1	upstream_gene_variant ; 348.0bp to feature; MODIFIER	silent_mutation	Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg1215669490	A -> T	LOC_Os12g26750.1	downstream_gene_variant ; 4507.0bp to feature; MODIFIER	silent_mutation	Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg1215669490	A -> T	LOC_Os12g26720-LOC_Os12g26740	intergenic_region ; MODIFIER	silent_mutation	Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215669490	1.99E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490	NA	7.34E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490	4.37E-06	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490	NA	1.57E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490	3.64E-07	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490	1.41E-06	1.41E-06	mr1846_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490	NA	1.11E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251