\
| Variant ID: vg1215669490 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15669490 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 112. )
CCTTTCTGTCGGACACCTTTTTATTTGCATCATAATAATTCCAAAGAATTATTAAACCGCGTTAAAAAGGATTTTAGCAGCATCGGGCCACATCATTGTG[A/T]
GTACAAATTGCCAAAGCAAAAAGCACCTAAGTCCCTAGGGATCACAACCGGCCACGCTGATTATAATATTGGGCTGAAGTACTGTACAGGCCCAGGACCA
TGGTCCTGGGCCTGTACAGTACTTCAGCCCAATATTATAATCAGCGTGGCCGGTTGTGATCCCTAGGGACTTAGGTGCTTTTTGCTTTGGCAATTTGTAC[T/A]
CACAATGATGTGGCCCGATGCTGCTAAAATCCTTTTTAACGCGGTTTAATAATTCTTTGGAATTATTATGATGCAAATAAAAAGGTGTCCGACAGAAAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 26.10% | 6.58% | 1.14% | NA |
| All Indica | 2759 | 57.90% | 29.10% | 11.05% | 1.88% | NA |
| All Japonica | 1512 | 77.70% | 22.00% | 0.26% | 0.07% | NA |
| Aus | 269 | 91.80% | 7.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 90.90% | 8.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 44.70% | 15.70% | 29.46% | 10.11% | NA |
| Indica III | 913 | 38.00% | 54.10% | 7.89% | 0.00% | NA |
| Indica Intermediate | 786 | 63.90% | 23.80% | 11.70% | 0.64% | NA |
| Temperate Japonica | 767 | 94.50% | 5.10% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 27.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 59.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 23.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215669490 | A -> DEL | N | N | silent_mutation | Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg1215669490 | A -> T | LOC_Os12g26740.1 | upstream_gene_variant ; 348.0bp to feature; MODIFIER | silent_mutation | Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg1215669490 | A -> T | LOC_Os12g26750.1 | downstream_gene_variant ; 4507.0bp to feature; MODIFIER | silent_mutation | Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg1215669490 | A -> T | LOC_Os12g26720-LOC_Os12g26740 | intergenic_region ; MODIFIER | silent_mutation | Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215669490 | 1.99E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215669490 | NA | 7.34E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215669490 | 4.37E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215669490 | NA | 1.57E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215669490 | 3.64E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215669490 | 1.41E-06 | 1.41E-06 | mr1846_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215669490 | NA | 1.11E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |