\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215669490:

Variant ID: vg1215669490 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15669490
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTCTGTCGGACACCTTTTTATTTGCATCATAATAATTCCAAAGAATTATTAAACCGCGTTAAAAAGGATTTTAGCAGCATCGGGCCACATCATTGTG[A/T]
GTACAAATTGCCAAAGCAAAAAGCACCTAAGTCCCTAGGGATCACAACCGGCCACGCTGATTATAATATTGGGCTGAAGTACTGTACAGGCCCAGGACCA

Reverse complement sequence

TGGTCCTGGGCCTGTACAGTACTTCAGCCCAATATTATAATCAGCGTGGCCGGTTGTGATCCCTAGGGACTTAGGTGCTTTTTGCTTTGGCAATTTGTAC[T/A]
CACAATGATGTGGCCCGATGCTGCTAAAATCCTTTTTAACGCGGTTTAATAATTCTTTGGAATTATTATGATGCAAATAAAAAGGTGTCCGACAGAAAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 26.10% 6.58% 1.14% NA
All Indica  2759 57.90% 29.10% 11.05% 1.88% NA
All Japonica  1512 77.70% 22.00% 0.26% 0.07% NA
Aus  269 91.80% 7.80% 0.37% 0.00% NA
Indica I  595 90.90% 8.40% 0.67% 0.00% NA
Indica II  465 44.70% 15.70% 29.46% 10.11% NA
Indica III  913 38.00% 54.10% 7.89% 0.00% NA
Indica Intermediate  786 63.90% 23.80% 11.70% 0.64% NA
Temperate Japonica  767 94.50% 5.10% 0.26% 0.13% NA
Tropical Japonica  504 55.00% 45.00% 0.00% 0.00% NA
Japonica Intermediate  241 71.80% 27.40% 0.83% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215669490 A -> DEL N N silent_mutation Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg1215669490 A -> T LOC_Os12g26740.1 upstream_gene_variant ; 348.0bp to feature; MODIFIER silent_mutation Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg1215669490 A -> T LOC_Os12g26750.1 downstream_gene_variant ; 4507.0bp to feature; MODIFIER silent_mutation Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg1215669490 A -> T LOC_Os12g26720-LOC_Os12g26740 intergenic_region ; MODIFIER silent_mutation Average:33.475; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215669490 1.99E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490 NA 7.34E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490 4.37E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490 NA 1.57E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490 3.64E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490 1.41E-06 1.41E-06 mr1846_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215669490 NA 1.11E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251