\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215662789:

Variant ID: vg1215662789 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15662789
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCGCCATGTCATCGTCCACGTGACATGCCACATAGGCAAGACCACAGTCAAACCAGCATTTGGTCTAGGATGATACATTAAACCAAGTTTAAAGATCT[C/T]
GATGAGAGTTTTGCAATTTCGTGGACCTACAAGGTTAAGGACCGCTAGTGTAATTTACTCTATTTAATACTTAATTAATCTTGCGCTATTGAACTACGTC

Reverse complement sequence

GACGTAGTTCAATAGCGCAAGATTAATTAAGTATTAAATAGAGTAAATTACACTAGCGGTCCTTAACCTTGTAGGTCCACGAAATTGCAAAACTCTCATC[G/A]
AGATCTTTAAACTTGGTTTAATGTATCATCCTAGACCAAATGCTGGTTTGACTGTGGTCTTGCCTATGTGGCATGTCACGTGGACGATGACATGGCGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 7.60% 7.09% 34.64% NA
All Indica  2759 49.80% 1.30% 5.15% 43.75% NA
All Japonica  1512 45.50% 20.60% 12.04% 21.83% NA
Aus  269 91.10% 0.00% 0.74% 8.18% NA
Indica I  595 86.40% 0.30% 4.37% 8.91% NA
Indica II  465 22.80% 3.00% 11.61% 62.58% NA
Indica III  913 36.10% 1.50% 0.88% 61.45% NA
Indica Intermediate  786 53.90% 0.80% 6.87% 38.42% NA
Temperate Japonica  767 34.90% 39.20% 20.34% 5.48% NA
Tropical Japonica  504 55.40% 0.20% 0.40% 44.05% NA
Japonica Intermediate  241 58.50% 4.10% 9.96% 27.39% NA
VI/Aromatic  96 40.60% 0.00% 1.04% 58.33% NA
Intermediate  90 54.40% 12.20% 8.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215662789 C -> DEL N N silent_mutation Average:34.768; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1215662789 C -> T LOC_Os12g26720.1 upstream_gene_variant ; 92.0bp to feature; MODIFIER silent_mutation Average:34.768; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1215662789 C -> T LOC_Os12g26720-LOC_Os12g26740 intergenic_region ; MODIFIER silent_mutation Average:34.768; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215662789 NA 6.39E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 7.59E-06 mr1161 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.00E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.10E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 4.58E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.01E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 3.80E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 7.85E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 2.59E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 4.79E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 5.51E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.17E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 6.67E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 6.99E-09 mr1161_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.98E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 6.18E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 3.58E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.23E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 2.35E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 3.49E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 1.37E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 3.75E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215662789 NA 5.39E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251