\
| Variant ID: vg1215654794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15654794 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 27. )
AGTTAGATTTGATTCAGTGCACCGAGCAGGAGAAGGTTTCTTTTGCTTCGCACCATTTGCATGGTCCTGCTGCTGAGTGGTGGGATCACTTTCGTCAAAA[C/T,G]
AGAGCTGCGGGAGAGCCTATCACTTGGCAGGAGTTTACTGCTGCTTTCAAGAAGACACATATACCATCAGGTGTCGTGGCACTTAAGAAGAGAGAATTCA
TGAATTCTCTCTTCTTAAGTGCCACGACACCTGATGGTATATGTGTCTTCTTGAAAGCAGCAGTAAACTCCTGCCAAGTGATAGGCTCTCCCGCAGCTCT[G/A,C]
TTTTGACGAAAGTGATCCCACCACTCAGCAGCAGGACCATGCAAATGGTGCGAAGCAAAAGAAACCTTCTCCTGCTCGGTGCACTGAATCAAATCTAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 4.80% | 3.17% | 4.91% | G: 0.02% |
| All Indica | 2759 | 90.30% | 3.30% | 4.06% | 2.28% | NA |
| All Japonica | 1512 | 83.00% | 8.30% | 0.60% | 8.13% | NA |
| Aus | 269 | 77.30% | 0.00% | 9.29% | 13.38% | NA |
| Indica I | 595 | 96.10% | 0.20% | 3.03% | 0.67% | NA |
| Indica II | 465 | 75.50% | 15.70% | 5.81% | 3.01% | NA |
| Indica III | 913 | 94.20% | 0.10% | 3.50% | 2.19% | NA |
| Indica Intermediate | 786 | 90.20% | 2.20% | 4.45% | 3.18% | NA |
| Temperate Japonica | 767 | 96.90% | 0.30% | 0.13% | 2.74% | NA |
| Tropical Japonica | 504 | 59.90% | 23.60% | 0.79% | 15.67% | NA |
| Japonica Intermediate | 241 | 87.10% | 1.70% | 1.66% | 9.54% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 3.12% | 4.17% | G: 1.04% |
| Intermediate | 90 | 78.90% | 13.30% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215654794 | C -> DEL | LOC_Os12g26710.1 | N | frameshift_variant | Average:24.47; most accessible tissue: Minghui63 flag leaf, score: 42.823 | N | N | N | N |
| vg1215654794 | C -> G | LOC_Os12g26710.1 | missense_variant ; p.Asn670Lys; MODERATE | nonsynonymous_codon | Average:24.47; most accessible tissue: Minghui63 flag leaf, score: 42.823 | possibly damaging |
1.573 |
DELETERIOUS | 0.01 |
| vg1215654794 | C -> T | LOC_Os12g26710.1 | synonymous_variant ; p.Asn670Asn; LOW | synonymous_codon | Average:24.47; most accessible tissue: Minghui63 flag leaf, score: 42.823 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215654794 | NA | 1.37E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | NA | 8.01E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 3.82E-09 | 2.35E-12 | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | NA | 1.14E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | NA | 2.55E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 5.95E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 6.43E-07 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 7.71E-06 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 6.98E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | NA | 3.46E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 1.40E-07 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 1.07E-06 | NA | mr1136_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 9.01E-06 | 5.18E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 3.57E-07 | NA | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 5.69E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 6.99E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 2.21E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654794 | 4.08E-06 | 1.85E-06 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |