\
| Variant ID: vg1215654384 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15654384 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTAAGTTAGTTGGTGAGATAGTGTTAACTCAATTTAAATGTAATCATACACAGTTAAGAGCAATATAGAATTTAAATTAATTAAAGTTCTCTGTTCTA[T/A]
GGGTATCTCTCTATCGTTCTTTCCTTTGCCCGTGCTTTCTTCAGATGGTGAACACCCGCACTGGAGGTGGAGGTGGAAGTGGAAGTGGTCACAATGAAGG
CCTTCATTGTGACCACTTCCACTTCCACCTCCACCTCCAGTGCGGGTGTTCACCATCTGAAGAAAGCACGGGCAAAGGAAAGAACGATAGAGAGATACCC[A/T]
TAGAACAGAGAACTTTAATTAATTTAAATTCTATATTGCTCTTAACTGTGTATGATTACATTTAAATTGAGTTAACACTATCTCACCAACTAACTTACTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.30% | 10.60% | 3.91% | 52.22% | NA |
| All Indica | 2759 | 14.10% | 3.20% | 6.42% | 76.37% | NA |
| All Japonica | 1512 | 68.10% | 21.00% | 0.07% | 10.85% | NA |
| Aus | 269 | 37.20% | 8.90% | 0.74% | 53.16% | NA |
| Indica I | 595 | 10.80% | 0.00% | 3.36% | 85.88% | NA |
| Indica II | 465 | 32.50% | 10.50% | 3.87% | 53.12% | NA |
| Indica III | 913 | 3.60% | 2.50% | 10.08% | 83.79% | NA |
| Indica Intermediate | 786 | 17.80% | 1.90% | 5.98% | 74.30% | NA |
| Temperate Japonica | 767 | 91.70% | 4.30% | 0.00% | 4.04% | NA |
| Tropical Japonica | 504 | 34.30% | 45.80% | 0.00% | 19.84% | NA |
| Japonica Intermediate | 241 | 63.90% | 22.00% | 0.41% | 13.69% | NA |
| VI/Aromatic | 96 | 12.50% | 58.30% | 3.12% | 26.04% | NA |
| Intermediate | 90 | 47.80% | 17.80% | 2.22% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215654384 | T -> DEL | N | N | silent_mutation | Average:25.711; most accessible tissue: Minghui63 flag leaf, score: 42.823 | N | N | N | N |
| vg1215654384 | T -> A | LOC_Os12g26710.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.711; most accessible tissue: Minghui63 flag leaf, score: 42.823 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215654384 | NA | 1.28E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654384 | NA | 8.81E-10 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654384 | 1.93E-07 | 1.19E-16 | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654384 | 1.11E-06 | NA | mr1051_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654384 | 3.40E-07 | 1.49E-14 | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215654384 | NA | 4.05E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |