\
| Variant ID: vg1215653812 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15653812 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGGAGCTTACAACTGTCCTGAGGTGAAGGTAGCGCCACTCTAACGCATGCTGTGTATATGCTTAGTGCCATGGATGCAGTAGGCGTGGAGCGGGAGAAAG[T/C]
AGCTCATGATAGGGAAAACTGGAACCGTGGCAGGATTTGCATGTTGGAGAGCAAGGTGTACTGTCTACAGAAGGAACTGGCTGAGCATAAGGGAGAAGCA
TGCTTCTCCCTTATGCTCAGCCAGTTCCTTCTGTAGACAGTACACCTTGCTCTCCAACATGCAAATCCTGCCACGGTTCCAGTTTTCCCTATCATGAGCT[A/G]
CTTTCTCCCGCTCCACGCCTACTGCATCCATGGCACTAAGCATATACACAGCATGCGTTAGAGTGGCGCTACCTTCACCTCAGGACAGTTGTAAGCTCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.80% | 17.50% | 4.51% | 42.21% | NA |
| All Indica | 2759 | 26.20% | 7.10% | 7.10% | 59.55% | NA |
| All Japonica | 1512 | 59.70% | 29.20% | 0.46% | 10.65% | NA |
| Aus | 269 | 8.20% | 37.90% | 2.60% | 51.30% | NA |
| Indica I | 595 | 11.40% | 0.50% | 6.05% | 82.02% | NA |
| Indica II | 465 | 41.30% | 26.20% | 8.82% | 23.66% | NA |
| Indica III | 913 | 25.10% | 2.40% | 7.01% | 65.50% | NA |
| Indica Intermediate | 786 | 29.90% | 6.20% | 7.00% | 56.87% | NA |
| Temperate Japonica | 767 | 91.80% | 4.40% | 0.00% | 3.78% | NA |
| Tropical Japonica | 504 | 9.90% | 69.40% | 1.19% | 19.44% | NA |
| Japonica Intermediate | 241 | 61.80% | 23.70% | 0.41% | 14.11% | NA |
| VI/Aromatic | 96 | 11.50% | 60.40% | 0.00% | 28.12% | NA |
| Intermediate | 90 | 35.60% | 32.20% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215653812 | T -> C | LOC_Os12g26710.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.675; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1215653812 | T -> DEL | N | N | silent_mutation | Average:33.675; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215653812 | 6.40E-07 | NA | mr1180 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 3.15E-06 | NA | mr1180 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.15E-09 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 2.05E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 1.31E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 2.22E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 1.59E-07 | 1.42E-06 | mr1294 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 3.99E-06 | 8.27E-09 | mr1302 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 1.79E-06 | NA | mr1314 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 5.81E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 2.40E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 1.92E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 9.00E-06 | 9.02E-06 | mr1370 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.07E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 2.27E-06 | 3.54E-08 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 5.39E-06 | 5.57E-15 | mr1401 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.53E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 5.37E-08 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 5.11E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 1.79E-07 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 6.38E-07 | 6.38E-07 | mr1450 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 2.34E-06 | 5.00E-06 | mr1485 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 7.62E-06 | NA | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.10E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.14E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 2.73E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 6.01E-08 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 2.67E-06 | NA | mr1635 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 6.13E-06 | 2.19E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 9.83E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 7.74E-06 | NA | mr1820 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 8.37E-10 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 4.05E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 3.76E-06 | NA | mr1909 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.71E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | 9.62E-07 | NA | mr1943 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653812 | NA | 3.95E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |