\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215653764:

Variant ID: vg1215653764 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15653764
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCATCAGCTTTCCAGTATCATCCACACAAGCCTCATGGTCAAGACTATGGAGCTTACAACTGTCCTGAGGTGAAGGTAGCGCCACTCTAACGCATGCTG[T/C]
GTATATGCTTAGTGCCATGGATGCAGTAGGCGTGGAGCGGGAGAAAGTAGCTCATGATAGGGAAAACTGGAACCGTGGCAGGATTTGCATGTTGGAGAGC

Reverse complement sequence

GCTCTCCAACATGCAAATCCTGCCACGGTTCCAGTTTTCCCTATCATGAGCTACTTTCTCCCGCTCCACGCCTACTGCATCCATGGCACTAAGCATATAC[A/G]
CAGCATGCGTTAGAGTGGCGCTACCTTCACCTCAGGACAGTTGTAAGCTCCATAGTCTTGACCATGAGGCTTGTGTGGATGATACTGGAAAGCTGATGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 17.60% 4.61% 48.98% NA
All Indica  2759 14.20% 7.30% 7.61% 70.90% NA
All Japonica  1512 59.70% 29.20% 0.20% 10.98% NA
Aus  269 8.90% 38.30% 1.49% 51.30% NA
Indica I  595 10.90% 0.70% 2.69% 85.71% NA
Indica II  465 21.30% 26.90% 9.89% 41.94% NA
Indica III  913 10.20% 2.50% 9.53% 77.77% NA
Indica Intermediate  786 17.00% 6.40% 7.76% 68.83% NA
Temperate Japonica  767 91.40% 4.40% 0.13% 4.04% NA
Tropical Japonica  504 10.30% 69.20% 0.40% 20.04% NA
Japonica Intermediate  241 61.80% 24.10% 0.00% 14.11% NA
VI/Aromatic  96 12.50% 58.30% 1.04% 28.12% NA
Intermediate  90 35.60% 33.30% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215653764 T -> C LOC_Os12g26710.1 intron_variant ; MODIFIER silent_mutation Average:32.214; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1215653764 T -> DEL N N silent_mutation Average:32.214; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215653764 NA 1.61E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 3.35E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 3.58E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 4.92E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 4.78E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 4.26E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 1.15E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 8.45E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 3.40E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 6.74E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 1.78E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 1.03E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 3.27E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 3.91E-11 2.11E-18 mr1022_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 1.10E-06 2.52E-13 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 1.91E-07 1.50E-16 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 1.69E-08 4.30E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 1.70E-06 7.91E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 1.26E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 8.48E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 1.30E-06 2.88E-17 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 2.54E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 9.01E-08 2.14E-16 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215653764 NA 6.72E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251