\
| Variant ID: vg1215653080 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15653080 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTTTCTAAATCCTACTTTGCAAAACAGAAAGTTGTTCTATTCTAATTTTTCTTTTTCCTTTACTGTTAAGGGTATTAAATAGTTTCCTGAATTTAAGTG[G/A]
TTAGTCGGCACTGTACATCTATTATGGTATCGATTGAATCAAGATAGCACTAGTACTAGTCATCCCTCTTAATGGTGACACTGTACCGTGCCTGTATAGA
TCTATACAGGCACGGTACAGTGTCACCATTAAGAGGGATGACTAGTACTAGTGCTATCTTGATTCAATCGATACCATAATAGATGTACAGTGCCGACTAA[C/T]
CACTTAAATTCAGGAAACTATTTAATACCCTTAACAGTAAAGGAAAAAGAAAAATTAGAATAGAACAACTTTCTGTTTTGCAAAGTAGGATTTAGAAAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.90% | 0.10% | 6.56% | 47.44% | NA |
| All Indica | 2759 | 20.60% | 0.10% | 8.63% | 70.68% | NA |
| All Japonica | 1512 | 89.20% | 0.00% | 0.46% | 10.38% | NA |
| Aus | 269 | 46.50% | 0.40% | 17.84% | 35.32% | NA |
| Indica I | 595 | 12.40% | 0.30% | 3.70% | 83.53% | NA |
| Indica II | 465 | 47.30% | 0.00% | 9.46% | 43.23% | NA |
| Indica III | 913 | 9.90% | 0.00% | 11.94% | 78.20% | NA |
| Indica Intermediate | 786 | 23.30% | 0.30% | 8.02% | 68.45% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 80.20% | 0.00% | 0.99% | 18.85% | NA |
| Japonica Intermediate | 241 | 86.30% | 0.00% | 0.41% | 13.28% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 11.46% | 17.71% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 6.67% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215653080 | G -> DEL | N | N | silent_mutation | Average:19.561; most accessible tissue: Minghui63 flag leaf, score: 38.911 | N | N | N | N |
| vg1215653080 | G -> A | LOC_Os12g26710.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.561; most accessible tissue: Minghui63 flag leaf, score: 38.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215653080 | NA | 7.41E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | NA | 1.12E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | NA | 3.31E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | 1.08E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | 2.34E-08 | 2.25E-14 | mr1023_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | NA | 7.95E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | NA | 5.85E-12 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | NA | 4.15E-13 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | 6.66E-06 | 6.42E-10 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215653080 | NA | 1.50E-12 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |