\
| Variant ID: vg1215610968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15610968 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 54. )
TAAAGCGATAATGCAGTAATTTAAACCAAAATAATTTTATAAACTGGGATTCAATATGTTCAAGGATGATGTGACTTGCCTTGCTCGCTTTCCCAAACGT[T/C]
GGCTTCAACCTCCACGTAGAGCGGATCTTCCGGAGCTGCAGCGTCTACACGACCAACGGAAAGAAAAATGCTTTTACTCTAACAAACTCCATATAACAAG
CTTGTTATATGGAGTTTGTTAGAGTAAAAGCATTTTTCTTTCCGTTGGTCGTGTAGACGCTGCAGCTCCGGAAGATCCGCTCTACGTGGAGGTTGAAGCC[A/G]
ACGTTTGGGAAAGCGAGCAAGGCAAGTCACATCATCCTTGAACATATTGAATCCCAGTTTATAAAATTATTTTGGTTTAAATTACTGCATTATCGCTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.90% | 28.10% | 22.43% | 15.59% | NA |
| All Indica | 2759 | 44.00% | 11.80% | 31.93% | 12.21% | NA |
| All Japonica | 1512 | 12.80% | 60.10% | 6.55% | 20.57% | NA |
| Aus | 269 | 52.40% | 20.10% | 18.96% | 8.55% | NA |
| Indica I | 595 | 68.90% | 10.10% | 15.29% | 5.71% | NA |
| Indica II | 465 | 17.40% | 25.60% | 26.24% | 30.75% | NA |
| Indica III | 913 | 40.60% | 4.90% | 47.21% | 7.23% | NA |
| Indica Intermediate | 786 | 44.90% | 13.00% | 30.15% | 11.96% | NA |
| Temperate Japonica | 767 | 2.70% | 91.40% | 1.43% | 4.43% | NA |
| Tropical Japonica | 504 | 29.20% | 11.70% | 14.29% | 44.84% | NA |
| Japonica Intermediate | 241 | 10.40% | 61.80% | 6.64% | 21.16% | NA |
| VI/Aromatic | 96 | 28.10% | 11.50% | 3.12% | 57.29% | NA |
| Intermediate | 90 | 26.70% | 32.20% | 28.89% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215610968 | T -> C | LOC_Os12g26650.1 | upstream_gene_variant ; 620.0bp to feature; MODIFIER | silent_mutation | Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 | N | N | N | N |
| vg1215610968 | T -> C | LOC_Os12g26640.1 | downstream_gene_variant ; 1535.0bp to feature; MODIFIER | silent_mutation | Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 | N | N | N | N |
| vg1215610968 | T -> C | LOC_Os12g26640-LOC_Os12g26650 | intergenic_region ; MODIFIER | silent_mutation | Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 | N | N | N | N |
| vg1215610968 | T -> DEL | N | N | silent_mutation | Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215610968 | NA | 5.34E-12 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 9.73E-12 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 4.05E-11 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 8.12E-08 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 8.32E-06 | mr1577 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 1.81E-36 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 2.57E-15 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 4.71E-11 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 4.53E-16 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | 3.75E-06 | 2.51E-15 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 6.30E-14 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 1.38E-15 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | 9.22E-08 | 2.80E-16 | mr1390_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 9.80E-07 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 7.22E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | 3.30E-07 | 1.04E-14 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 1.05E-08 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 7.72E-08 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 6.69E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215610968 | NA | 1.37E-06 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |