\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215610968:

Variant ID: vg1215610968 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15610968
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGCGATAATGCAGTAATTTAAACCAAAATAATTTTATAAACTGGGATTCAATATGTTCAAGGATGATGTGACTTGCCTTGCTCGCTTTCCCAAACGT[T/C]
GGCTTCAACCTCCACGTAGAGCGGATCTTCCGGAGCTGCAGCGTCTACACGACCAACGGAAAGAAAAATGCTTTTACTCTAACAAACTCCATATAACAAG

Reverse complement sequence

CTTGTTATATGGAGTTTGTTAGAGTAAAAGCATTTTTCTTTCCGTTGGTCGTGTAGACGCTGCAGCTCCGGAAGATCCGCTCTACGTGGAGGTTGAAGCC[A/G]
ACGTTTGGGAAAGCGAGCAAGGCAAGTCACATCATCCTTGAACATATTGAATCCCAGTTTATAAAATTATTTTGGTTTAAATTACTGCATTATCGCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 28.10% 22.43% 15.59% NA
All Indica  2759 44.00% 11.80% 31.93% 12.21% NA
All Japonica  1512 12.80% 60.10% 6.55% 20.57% NA
Aus  269 52.40% 20.10% 18.96% 8.55% NA
Indica I  595 68.90% 10.10% 15.29% 5.71% NA
Indica II  465 17.40% 25.60% 26.24% 30.75% NA
Indica III  913 40.60% 4.90% 47.21% 7.23% NA
Indica Intermediate  786 44.90% 13.00% 30.15% 11.96% NA
Temperate Japonica  767 2.70% 91.40% 1.43% 4.43% NA
Tropical Japonica  504 29.20% 11.70% 14.29% 44.84% NA
Japonica Intermediate  241 10.40% 61.80% 6.64% 21.16% NA
VI/Aromatic  96 28.10% 11.50% 3.12% 57.29% NA
Intermediate  90 26.70% 32.20% 28.89% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215610968 T -> C LOC_Os12g26650.1 upstream_gene_variant ; 620.0bp to feature; MODIFIER silent_mutation Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 N N N N
vg1215610968 T -> C LOC_Os12g26640.1 downstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 N N N N
vg1215610968 T -> C LOC_Os12g26640-LOC_Os12g26650 intergenic_region ; MODIFIER silent_mutation Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 N N N N
vg1215610968 T -> DEL N N silent_mutation Average:6.794; most accessible tissue: Zhenshan97 flag leaf, score: 15.873 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215610968 NA 5.34E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 9.73E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 4.05E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 8.12E-08 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 8.32E-06 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 1.81E-36 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 2.57E-15 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 4.71E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 4.53E-16 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 3.75E-06 2.51E-15 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 6.30E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 1.38E-15 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 9.22E-08 2.80E-16 mr1390_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 9.80E-07 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 7.22E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 3.30E-07 1.04E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 1.05E-08 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 7.72E-08 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 6.69E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215610968 NA 1.37E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251