Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215609580:

Variant ID: vg1215609580 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15609580
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACCAAAAGTTGATACAATTCAAAGTTTAACAAGCGGAAGCATAAATAGTTAATTTATTACATGGGCGACGAAGGCCCAGCACACATAAAGATAAACGG[C/A]
AAACAGCGGAAGACTAGGGCGACGACCACAGGCACTTGACGGCAGGCACGAGCTAGACACCAAAGCCTTCATCTTCCAGGAACTCCTCTTCTGGGTTTGG

Reverse complement sequence

CCAAACCCAGAAGAGGAGTTCCTGGAAGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGTGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTT[G/T]
CCGTTTATCTTTATGTGTGCTGGGCCTTCGTCGCCCATGTAATAAATTAACTATTTATGCTTCCGCTTGTTAAACTTTGAATTGTATCAACTTTTGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	23.30%	3.70%	11.21%	NA
All Indica	2759	90.40%	5.00%	2.25%	2.32%	NA
All Japonica	1512	12.00%	59.70%	4.10%	24.27%	NA
Aus	269	64.30%	8.20%	18.59%	8.92%	NA
Indica I	595	91.80%	8.20%	0.00%	0.00%	NA
Indica II	465	76.10%	5.20%	9.03%	9.68%	NA
Indica III	913	97.80%	1.00%	0.33%	0.88%	NA
Indica Intermediate	786	89.20%	7.30%	2.16%	1.40%	NA
Temperate Japonica	767	4.20%	91.50%	0.13%	4.17%	NA
Tropical Japonica	504	21.40%	10.50%	11.51%	56.55%	NA
Japonica Intermediate	241	17.00%	61.00%	1.24%	20.75%	NA
VI/Aromatic	96	31.20%	10.40%	1.04%	57.29%	NA
Intermediate	90	46.70%	31.10%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215609580	C -> DEL	N	N	silent_mutation	Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg1215609580	C -> A	LOC_Os12g26650.1	upstream_gene_variant ; 2008.0bp to feature; MODIFIER	silent_mutation	Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg1215609580	C -> A	LOC_Os12g26640.1	downstream_gene_variant ; 147.0bp to feature; MODIFIER	silent_mutation	Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg1215609580	C -> A	LOC_Os12g26640-LOC_Os12g26650	intergenic_region ; MODIFIER	silent_mutation	Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215609580	NA	9.41E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	1.22E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	4.57E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	3.50E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	5.16E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	3.69E-09	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	9.25E-08	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	4.79E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	2.63E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	8.61E-06	mr1324_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	8.89E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	9.06E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	2.26E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	3.16E-07	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	3.47E-06	mr1446_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	2.51E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	8.45E-08	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	3.75E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	2.36E-07	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	4.51E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	2.36E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	4.91E-07	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	4.50E-06	NA	mr1744_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	2.79E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	1.00E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	6.91E-06	NA	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	6.36E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	9.40E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580	NA	5.10E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251