\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215609580:

Variant ID: vg1215609580 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15609580
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACCAAAAGTTGATACAATTCAAAGTTTAACAAGCGGAAGCATAAATAGTTAATTTATTACATGGGCGACGAAGGCCCAGCACACATAAAGATAAACGG[C/A]
AAACAGCGGAAGACTAGGGCGACGACCACAGGCACTTGACGGCAGGCACGAGCTAGACACCAAAGCCTTCATCTTCCAGGAACTCCTCTTCTGGGTTTGG

Reverse complement sequence

CCAAACCCAGAAGAGGAGTTCCTGGAAGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGTGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTT[G/T]
CCGTTTATCTTTATGTGTGCTGGGCCTTCGTCGCCCATGTAATAAATTAACTATTTATGCTTCCGCTTGTTAAACTTTGAATTGTATCAACTTTTGGTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 23.30% 3.70% 11.21% NA
All Indica  2759 90.40% 5.00% 2.25% 2.32% NA
All Japonica  1512 12.00% 59.70% 4.10% 24.27% NA
Aus  269 64.30% 8.20% 18.59% 8.92% NA
Indica I  595 91.80% 8.20% 0.00% 0.00% NA
Indica II  465 76.10% 5.20% 9.03% 9.68% NA
Indica III  913 97.80% 1.00% 0.33% 0.88% NA
Indica Intermediate  786 89.20% 7.30% 2.16% 1.40% NA
Temperate Japonica  767 4.20% 91.50% 0.13% 4.17% NA
Tropical Japonica  504 21.40% 10.50% 11.51% 56.55% NA
Japonica Intermediate  241 17.00% 61.00% 1.24% 20.75% NA
VI/Aromatic  96 31.20% 10.40% 1.04% 57.29% NA
Intermediate  90 46.70% 31.10% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215609580 C -> DEL N N silent_mutation Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1215609580 C -> A LOC_Os12g26650.1 upstream_gene_variant ; 2008.0bp to feature; MODIFIER silent_mutation Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1215609580 C -> A LOC_Os12g26640.1 downstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1215609580 C -> A LOC_Os12g26640-LOC_Os12g26650 intergenic_region ; MODIFIER silent_mutation Average:7.914; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215609580 NA 9.41E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 1.22E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 4.57E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 3.50E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 5.16E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 3.69E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 9.25E-08 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 4.79E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 2.63E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 8.61E-06 mr1324_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 8.89E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 9.06E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 2.26E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 3.16E-07 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 3.47E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 2.51E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 8.45E-08 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 3.75E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 2.36E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 4.51E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 2.36E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 4.91E-07 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 4.50E-06 NA mr1744_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 2.79E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 1.00E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 6.91E-06 NA mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 6.36E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 9.40E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215609580 NA 5.10E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251