Search for Variation information by Variation ID:
Detailed information for vg1215609314:
| Variant ID: vg1215609314 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15609314 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TCGTATTTTTGAAGACGAGAGCGACAACGACAACGACGACGACGAGGTCGGCTCGGCCGGTCAGACCGGGCGCCAGGTCGGTCAGACCGCCGGCACACCT[C/T]
CGGTCAGACCGGCGCAGGATGTGCGGTCAGATCATCCAGGGTCGTTGGCTGAGGATCCTGTTGATGCTGTTCCAGATGGTCCTCCGGAAATTATGTCACG
Reverse complement sequence
CGTGACATAATTTCCGGAGGACCATCTGGAACAGCATCAACAGGATCCTCAGCCAACGACCCTGGATGATCTGACCGCACATCCTGCGCCGGTCTGACCG[G/A]
AGGTGTGCCGGCGGTCTGACCGACCTGGCGCCCGGTCTGACCGGCCGAGCCGACCTCGTCGTCGTCGTTGTCGTTGTCGCTCTCGTCTTCAAAAATACGA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 5.20% | 13.86% | 31.32% | NA |
| All Indica | 2759 | 45.90% | 0.70% | 18.77% | 34.65% | NA |
| All Japonica | 1512 | 56.00% | 13.00% | 5.82% | 25.13% | NA |
| Aus | 269 | 54.30% | 6.70% | 14.87% | 24.16% | NA |
| Indica I | 595 | 38.70% | 0.50% | 21.01% | 39.83% | NA |
| Indica II | 465 | 42.60% | 0.20% | 19.57% | 37.63% | NA |
| Indica III | 913 | 49.00% | 0.50% | 18.29% | 32.20% | NA |
| Indica Intermediate | 786 | 49.90% | 1.10% | 17.18% | 31.81% | NA |
| Temperate Japonica | 767 | 84.90% | 8.60% | 1.56% | 4.95% | NA |
| Tropical Japonica | 504 | 21.80% | 9.10% | 13.10% | 55.95% | NA |
| Japonica Intermediate | 241 | 35.70% | 35.30% | 4.15% | 24.90% | NA |
| VI/Aromatic | 96 | 31.20% | 10.40% | 0.00% | 58.33% | NA |
| Intermediate | 90 | 61.10% | 3.30% | 10.00% | 25.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215609314 | C -> DEL | LOC_Os12g26640.1 | N | frameshift_variant | Average:22.294; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg1215609314 | C -> T | LOC_Os12g26640.1 | missense_variant ; p.Pro691Ser; MODERATE | nonsynonymous_codon ; P691S | Average:22.294; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | benign  |
0.686 |
TOLERATED | 0.08 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215609314 | NA | 7.14E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 2.19E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 4.45E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 4.81E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 1.63E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 9.57E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 2.05E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | 3.67E-06 | NA | mr1486_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 1.03E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215609314 | NA | 3.21E-07 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |