Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215582087:

Variant ID: vg1215582087 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15582087
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCATAACTCTTATGACGAGACTGAGCCACTCGCAATCTTTCTTGAATGATCTTTACCTTTTCTTCCGCTTCCCTTAGGATATCCGTCCCGAAAACCTGAC[A/G]
TTCTCCCGTTTGATCCCACAAAAGCGGAGTGCGGCACTTCCGACCATACAGTGCTTCGTACGGAGCCATCTGAAGACTAGCTTGATAACTGTTGTTGTAC

Reverse complement sequence

GTACAACAACAGTTATCAAGCTAGTCTTCAGATGGCTCCGTACGAAGCACTGTATGGTCGGAAGTGCCGCACTCCGCTTTTGTGGGATCAAACGGGAGAA[T/C]
GTCAGGTTTTCGGGACGGATATCCTAAGGGAAGCGGAAGAAAAGGTAAAGATCATTCAAGAAAGATTGCGAGTGGCTCAGTCTCGTCATAAGAGTTATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.50%	2.60%	63.39%	9.42%	NA
All Indica	2759	6.60%	0.70%	81.15%	11.56%	NA
All Japonica	1512	60.20%	5.40%	31.94%	2.45%	NA
Aus	269	10.80%	0.00%	59.48%	29.74%	NA
Indica I	595	9.90%	0.70%	70.59%	18.82%	NA
Indica II	465	6.50%	0.00%	73.76%	19.78%	NA
Indica III	913	2.70%	1.30%	93.54%	2.41%	NA
Indica Intermediate	786	8.50%	0.50%	79.13%	11.83%	NA
Temperate Japonica	767	91.70%	0.50%	6.39%	1.43%	NA
Tropical Japonica	504	11.50%	14.50%	71.23%	2.78%	NA
Japonica Intermediate	241	61.80%	2.10%	31.12%	4.98%	NA
VI/Aromatic	96	10.40%	18.80%	66.67%	4.17%	NA
Intermediate	90	33.30%	5.60%	55.56%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215582087	A -> DEL	LOC_Os12g26610.1	N	frameshift_variant	Average:6.051; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1215582087	A -> G	LOC_Os12g26610.1	missense_variant ; p.Cys1231Arg; MODERATE	nonsynonymous_codon ; C1231R	Average:6.051; most accessible tissue: Minghui63 panicle, score: 20.733	probably damaging	-3.165	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215582087	NA	4.96E-14	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1215582087	NA	2.14E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	1.89E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	7.25E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	7.35E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	3.83E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	1.26E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	2.99E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	5.36E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	7.98E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	1.76E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	2.53E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	5.83E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	5.26E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	7.79E-06	mr1623_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	7.03E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	4.93E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087	NA	1.21E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251