\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215582087:

Variant ID: vg1215582087 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15582087
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATAACTCTTATGACGAGACTGAGCCACTCGCAATCTTTCTTGAATGATCTTTACCTTTTCTTCCGCTTCCCTTAGGATATCCGTCCCGAAAACCTGAC[A/G]
TTCTCCCGTTTGATCCCACAAAAGCGGAGTGCGGCACTTCCGACCATACAGTGCTTCGTACGGAGCCATCTGAAGACTAGCTTGATAACTGTTGTTGTAC

Reverse complement sequence

GTACAACAACAGTTATCAAGCTAGTCTTCAGATGGCTCCGTACGAAGCACTGTATGGTCGGAAGTGCCGCACTCCGCTTTTGTGGGATCAAACGGGAGAA[T/C]
GTCAGGTTTTCGGGACGGATATCCTAAGGGAAGCGGAAGAAAAGGTAAAGATCATTCAAGAAAGATTGCGAGTGGCTCAGTCTCGTCATAAGAGTTATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 2.60% 63.39% 9.42% NA
All Indica  2759 6.60% 0.70% 81.15% 11.56% NA
All Japonica  1512 60.20% 5.40% 31.94% 2.45% NA
Aus  269 10.80% 0.00% 59.48% 29.74% NA
Indica I  595 9.90% 0.70% 70.59% 18.82% NA
Indica II  465 6.50% 0.00% 73.76% 19.78% NA
Indica III  913 2.70% 1.30% 93.54% 2.41% NA
Indica Intermediate  786 8.50% 0.50% 79.13% 11.83% NA
Temperate Japonica  767 91.70% 0.50% 6.39% 1.43% NA
Tropical Japonica  504 11.50% 14.50% 71.23% 2.78% NA
Japonica Intermediate  241 61.80% 2.10% 31.12% 4.98% NA
VI/Aromatic  96 10.40% 18.80% 66.67% 4.17% NA
Intermediate  90 33.30% 5.60% 55.56% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215582087 A -> DEL LOC_Os12g26610.1 N frameshift_variant Average:6.051; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1215582087 A -> G LOC_Os12g26610.1 missense_variant ; p.Cys1231Arg; MODERATE nonsynonymous_codon ; C1231R Average:6.051; most accessible tissue: Minghui63 panicle, score: 20.733 probably damaging -3.165 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215582087 NA 4.96E-14 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1215582087 NA 2.14E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 1.89E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 7.25E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 7.35E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 3.83E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 1.26E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 2.99E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 5.36E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 7.98E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 1.76E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 2.53E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 5.83E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 5.26E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 7.79E-06 mr1623_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 7.03E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 4.93E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582087 NA 1.21E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251