\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215582061:

Variant ID: vg1215582061 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15582061
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTCAAATCTCTGCGGCGATTGTCGGCATAACTCTTATGACGAGACTGAGCCACTCGCAATCTTTCTTGAATGATCTTTACCTTTTCTTCCGCTTCCCT[T/C]
AGGATATCCGTCCCGAAAACCTGACATTCTCCCGTTTGATCCCACAAAAGCGGAGTGCGGCACTTCCGACCATACAGTGCTTCGTACGGAGCCATCTGAA

Reverse complement sequence

TTCAGATGGCTCCGTACGAAGCACTGTATGGTCGGAAGTGCCGCACTCCGCTTTTGTGGGATCAAACGGGAGAATGTCAGGTTTTCGGGACGGATATCCT[A/G]
AGGGAAGCGGAAGAAAAGGTAAAGATCATTCAAGAAAGATTGCGAGTGGCTCAGTCTCGTCATAAGAGTTATGCCGACAATCGCCGCAGAGATTTGAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 0.30% 11.47% 11.30% NA
All Indica  2759 69.40% 0.00% 14.50% 16.02% NA
All Japonica  1512 86.60% 0.70% 7.61% 5.09% NA
Aus  269 95.50% 0.00% 1.86% 2.60% NA
Indica I  595 70.30% 0.00% 7.23% 22.52% NA
Indica II  465 47.50% 0.00% 30.11% 22.37% NA
Indica III  913 81.70% 0.10% 9.42% 8.76% NA
Indica Intermediate  786 67.60% 0.00% 16.67% 15.78% NA
Temperate Japonica  767 95.40% 0.00% 1.04% 3.52% NA
Tropical Japonica  504 73.60% 1.80% 18.45% 6.15% NA
Japonica Intermediate  241 85.90% 0.40% 5.81% 7.88% NA
VI/Aromatic  96 79.20% 1.00% 18.75% 1.04% NA
Intermediate  90 87.80% 0.00% 4.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215582061 T -> C LOC_Os12g26610.1 synonymous_variant ; p.Leu1239Leu; LOW synonymous_codon Average:7.033; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1215582061 T -> DEL LOC_Os12g26610.1 N frameshift_variant Average:7.033; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215582061 NA 1.63E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1215582061 NA 1.61E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 2.69E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 4.65E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 2.94E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 3.60E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 4.31E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 2.84E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 1.74E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 6.23E-06 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 5.94E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 3.70E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 2.19E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 4.10E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 3.23E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 4.44E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 5.65E-06 4.06E-06 mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 2.19E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215582061 NA 2.49E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251