\
| Variant ID: vg1215582061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15582061 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AACTCAAATCTCTGCGGCGATTGTCGGCATAACTCTTATGACGAGACTGAGCCACTCGCAATCTTTCTTGAATGATCTTTACCTTTTCTTCCGCTTCCCT[T/C]
AGGATATCCGTCCCGAAAACCTGACATTCTCCCGTTTGATCCCACAAAAGCGGAGTGCGGCACTTCCGACCATACAGTGCTTCGTACGGAGCCATCTGAA
TTCAGATGGCTCCGTACGAAGCACTGTATGGTCGGAAGTGCCGCACTCCGCTTTTGTGGGATCAAACGGGAGAATGTCAGGTTTTCGGGACGGATATCCT[A/G]
AGGGAAGCGGAAGAAAAGGTAAAGATCATTCAAGAAAGATTGCGAGTGGCTCAGTCTCGTCATAAGAGTTATGCCGACAATCGCCGCAGAGATTTGAGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 0.30% | 11.47% | 11.30% | NA |
| All Indica | 2759 | 69.40% | 0.00% | 14.50% | 16.02% | NA |
| All Japonica | 1512 | 86.60% | 0.70% | 7.61% | 5.09% | NA |
| Aus | 269 | 95.50% | 0.00% | 1.86% | 2.60% | NA |
| Indica I | 595 | 70.30% | 0.00% | 7.23% | 22.52% | NA |
| Indica II | 465 | 47.50% | 0.00% | 30.11% | 22.37% | NA |
| Indica III | 913 | 81.70% | 0.10% | 9.42% | 8.76% | NA |
| Indica Intermediate | 786 | 67.60% | 0.00% | 16.67% | 15.78% | NA |
| Temperate Japonica | 767 | 95.40% | 0.00% | 1.04% | 3.52% | NA |
| Tropical Japonica | 504 | 73.60% | 1.80% | 18.45% | 6.15% | NA |
| Japonica Intermediate | 241 | 85.90% | 0.40% | 5.81% | 7.88% | NA |
| VI/Aromatic | 96 | 79.20% | 1.00% | 18.75% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215582061 | T -> C | LOC_Os12g26610.1 | synonymous_variant ; p.Leu1239Leu; LOW | synonymous_codon | Average:7.033; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1215582061 | T -> DEL | LOC_Os12g26610.1 | N | frameshift_variant | Average:7.033; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215582061 | NA | 1.63E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1215582061 | NA | 1.61E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 2.69E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 4.65E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 2.94E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 3.60E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 4.31E-08 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 2.84E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 1.74E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 6.23E-06 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 5.94E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 3.70E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 2.19E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 4.10E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 3.23E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 4.44E-06 | mr1686_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | 5.65E-06 | 4.06E-06 | mr1815_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 2.19E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215582061 | NA | 2.49E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |