| Variant ID: vg1215569613 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15569613 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATTATTTGTGCAGTTGTGATTAAAATAATTATACATGTGTGAAAATAATGGTACTTATGCCTATATTATTGTTAACCAACAATTGATAGATCCTGATAG[T/G]
TCTTTTTGGTATCTAGTAAAATTGGCTAGATATTTTACAACTTATTATTGTATCCAATTGCTAAGATGCACCTGCTAATTTTTTTCTATATGCTGCATTT
AAATGCAGCATATAGAAAAAAATTAGCAGGTGCATCTTAGCAATTGGATACAATAATAAGTTGTAAAATATCTAGCCAATTTTACTAGATACCAAAAAGA[A/C]
CTATCAGGATCTATCAATTGTTGGTTAACAATAATATAGGCATAAGTACCATTATTTTCACACATGTATAATTATTTTAATCACAACTGCACAAATAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 0.70% | 1.12% | 10.18% | NA |
| All Indica | 2759 | 96.60% | 0.00% | 0.43% | 2.97% | NA |
| All Japonica | 1512 | 76.40% | 2.10% | 2.31% | 19.18% | NA |
| Aus | 269 | 78.40% | 0.00% | 0.74% | 20.82% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 87.10% | 0.00% | 0.22% | 12.69% | NA |
| Indica III | 913 | 99.10% | 0.00% | 0.11% | 0.77% | NA |
| Indica Intermediate | 786 | 97.30% | 0.00% | 0.64% | 2.04% | NA |
| Temperate Japonica | 767 | 90.50% | 3.30% | 2.48% | 3.78% | NA |
| Tropical Japonica | 504 | 55.80% | 0.60% | 1.59% | 42.06% | NA |
| Japonica Intermediate | 241 | 74.70% | 1.70% | 3.32% | 20.33% | NA |
| VI/Aromatic | 96 | 47.90% | 0.00% | 3.12% | 48.96% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215569613 | T -> DEL | N | N | silent_mutation | Average:40.823; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1215569613 | T -> G | LOC_Os12g26590.1 | downstream_gene_variant ; 4019.0bp to feature; MODIFIER | silent_mutation | Average:40.823; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1215569613 | T -> G | LOC_Os12g26580-LOC_Os12g26590 | intergenic_region ; MODIFIER | silent_mutation | Average:40.823; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215569613 | 6.84E-06 | 6.84E-06 | mr1357_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215569613 | NA | 3.88E-06 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215569613 | NA | 4.15E-06 | mr1441_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215569613 | NA | 4.06E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215569613 | NA | 6.62E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215569613 | 9.18E-06 | 9.18E-06 | mr1785_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |