\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215566706:

Variant ID: vg1215566706 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15566706
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, T: 0.21, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAACAAAAGATGTAAATATTTGGATTTCATTACTGATCAATGATACATTTTTGGGCATCACTACTACAAAAATAATTTTATTGGATGAGACCCTCGTT[T/A]
GGTTGCAAATGGACCATAACTAACCACGTCTGTAAAAATTGACTTCCATTTTCGCACACGGCTCCTTAAAAGACACATTGGAAAAATAGATTTTTGCATA

Reverse complement sequence

TATGCAAAAATCTATTTTTCCAATGTGTCTTTTAAGGAGCCGTGTGCGAAAATGGAAGTCAATTTTTACAGACGTGGTTAGTTATGGTCCATTTGCAACC[A/T]
AACGAGGGTCTCATCCAATAAAATTATTTTTGTAGTAGTGATGCCCAAAAATGTATCATTGATCAGTAATGAAATCCAAATATTTACATCTTTTGTTTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 38.70% 0.30% 8.48% NA
All Indica  2759 78.90% 18.90% 0.22% 1.96% NA
All Japonica  1512 11.40% 70.10% 0.33% 18.19% NA
Aus  269 31.60% 60.60% 0.74% 7.06% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 41.10% 49.90% 0.86% 8.17% NA
Indica III  913 89.00% 10.10% 0.00% 0.88% NA
Indica Intermediate  786 75.30% 23.40% 0.25% 1.02% NA
Temperate Japonica  767 1.70% 95.20% 0.13% 3.00% NA
Tropical Japonica  504 26.40% 31.30% 0.79% 41.47% NA
Japonica Intermediate  241 10.80% 71.40% 0.00% 17.84% NA
VI/Aromatic  96 7.30% 42.70% 1.04% 48.96% NA
Intermediate  90 46.70% 46.70% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215566706 T -> DEL N N silent_mutation Average:18.09; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1215566706 T -> A LOC_Os12g26580-LOC_Os12g26590 intergenic_region ; MODIFIER silent_mutation Average:18.09; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215566706 4.83E-06 NA mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 1.28E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 5.08E-06 NA mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 3.04E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 9.72E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 7.32E-06 NA mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 1.74E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 3.95E-06 3.95E-06 mr1275 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 5.86E-06 NA mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 1.47E-07 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 9.10E-07 4.04E-14 mr1376 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 4.54E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 1.01E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 2.09E-07 NA mr1417 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 6.67E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 1.72E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 9.10E-07 4.04E-14 mr1431 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 5.33E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 9.50E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 2.82E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 2.69E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 3.71E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 4.75E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 4.15E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 7.61E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 4.29E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 7.62E-07 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 2.30E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 2.75E-06 NA mr1906 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 8.68E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215566706 NA 2.50E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251