\
| Variant ID: vg1215551723 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15551723 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, T: 0.01, others allele: 0.00, population size: 100. )
GTGTGGGTTCATGGCCTTGTTTAAATAACATTGTGTAGCTCTAGGATCGTGTTTTCAAAATGGCCCTGAGCAACTAAAAGTCTTTTTAATGCTGTTTACT[A/G]
CAAACCTTAACCCCTTTATTATATCTCCCTTGTACTCCTTTGCATTTATTCTGCATTCGTGGGTGTGTCTTGTTGAGTACGGTGGTTGTACTCAATCTTG
CAAGATTGAGTACAACCACCGTACTCAACAAGACACACCCACGAATGCAGAATAAATGCAAAGGAGTACAAGGGAGATATAATAAAGGGGTTAAGGTTTG[T/C]
AGTAAACAGCATTAAAAAGACTTTTAGTTGCTCAGGGCCATTTTGAAAACACGATCCTAGAGCTACACAATGTTATTTAAACAAGGCCATGAACCCACAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.10% | 3.40% | 27.11% | 46.34% | NA |
| All Indica | 2759 | 3.60% | 5.00% | 35.70% | 55.67% | NA |
| All Japonica | 1512 | 61.20% | 0.90% | 5.56% | 32.34% | NA |
| Aus | 269 | 9.30% | 3.30% | 66.17% | 21.19% | NA |
| Indica I | 595 | 2.00% | 7.60% | 45.38% | 45.04% | NA |
| Indica II | 465 | 6.50% | 8.00% | 42.37% | 43.23% | NA |
| Indica III | 913 | 1.20% | 2.40% | 26.62% | 69.77% | NA |
| Indica Intermediate | 786 | 6.00% | 4.30% | 34.99% | 54.71% | NA |
| Temperate Japonica | 767 | 92.20% | 0.40% | 1.83% | 5.61% | NA |
| Tropical Japonica | 504 | 13.10% | 1.60% | 10.91% | 74.40% | NA |
| Japonica Intermediate | 241 | 63.50% | 0.80% | 6.22% | 29.46% | NA |
| VI/Aromatic | 96 | 12.50% | 0.00% | 19.79% | 67.71% | NA |
| Intermediate | 90 | 32.20% | 3.30% | 16.67% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215551723 | A -> DEL | N | N | silent_mutation | Average:8.303; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
| vg1215551723 | A -> G | LOC_Os12g26570.1 | upstream_gene_variant ; 1797.0bp to feature; MODIFIER | silent_mutation | Average:8.303; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
| vg1215551723 | A -> G | LOC_Os12g26580.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.303; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215551723 | NA | 2.24E-50 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 1.24E-06 | 4.90E-46 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 5.08E-06 | 5.08E-39 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 1.59E-07 | 3.31E-72 | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 7.40E-45 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 2.99E-06 | 2.34E-58 | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 4.64E-06 | 5.22E-69 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 1.68E-08 | 1.08E-75 | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.45E-60 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 3.20E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 3.35E-21 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 3.58E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.17E-20 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 4.67E-08 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 6.74E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.41E-57 | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.09E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 9.08E-70 | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.26E-56 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | 6.38E-06 | 7.57E-74 | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.86E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.46E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.85E-07 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.49E-08 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.28E-11 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 5.39E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 5.48E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 8.62E-51 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 9.41E-82 | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 4.24E-54 | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 4.91E-66 | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 7.67E-78 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.90E-21 | mr1156_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 7.13E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.08E-78 | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 3.10E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 6.99E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.71E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 4.03E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.32E-21 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.67E-65 | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 6.93E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.24E-65 | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.83E-07 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 8.78E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 2.88E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 1.45E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 5.40E-13 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 6.00E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215551723 | NA | 3.69E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |