\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215548475:

Variant ID: vg1215548475 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15548475
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCAGCATTTTCAAAACTTCAACCTAGTGGTTGTTTGACATAAACTTCCTCTTGTATAAAACCATTTAGAAAATCACTTTTCACATCCATTTGATACA[G/A]
TTTAAAACCTTTTGAAGCAGCAAAAGCCAACAAAAGTCTAATTGCCTCAATTCTAGCAACAGGAGCAAAAGTTTCATCAAAATCCAAACCCTCAACTTGA

Reverse complement sequence

TCAAGTTGAGGGTTTGGATTTTGATGAAACTTTTGCTCCTGTTGCTAGAATTGAGGCAATTAGACTTTTGTTGGCTTTTGCTGCTTCAAAAGGTTTTAAA[C/T]
TGTATCAAATGGATGTGAAAAGTGATTTTCTAAATGGTTTTATACAAGAGGAAGTTTATGTCAAACAACCACTAGGTTGAAGTTTTGAAAATGCTGATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.20% 22.10% 31.00% 23.70% NA
All Indica  2759 3.80% 31.10% 48.97% 16.09% NA
All Japonica  1512 61.10% 9.80% 1.52% 27.58% NA
Aus  269 9.30% 4.80% 26.02% 59.85% NA
Indica I  595 2.50% 14.30% 59.83% 23.36% NA
Indica II  465 6.50% 7.70% 59.14% 26.67% NA
Indica III  913 1.40% 56.20% 34.50% 7.89% NA
Indica Intermediate  786 6.10% 28.50% 51.53% 13.87% NA
Temperate Japonica  767 92.20% 1.00% 0.65% 6.13% NA
Tropical Japonica  504 12.90% 24.20% 2.18% 60.71% NA
Japonica Intermediate  241 63.10% 7.50% 2.90% 26.56% NA
VI/Aromatic  96 13.50% 5.20% 2.08% 79.17% NA
Intermediate  90 33.30% 21.10% 21.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215548475 G -> DEL N N silent_mutation Average:9.326; most accessible tissue: Zhenshan97 flag leaf, score: 20.297 N N N N
vg1215548475 G -> A LOC_Os12g26580.1 downstream_gene_variant ; 2830.0bp to feature; MODIFIER silent_mutation Average:9.326; most accessible tissue: Zhenshan97 flag leaf, score: 20.297 N N N N
vg1215548475 G -> A LOC_Os12g26570.1 intron_variant ; MODIFIER silent_mutation Average:9.326; most accessible tissue: Zhenshan97 flag leaf, score: 20.297 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215548475 8.74E-06 8.74E-06 mr1041 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 6.56E-07 mr1057 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 8.93E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 3.77E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 5.01E-15 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 3.73E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.99E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 3.02E-08 3.02E-08 mr1275 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 8.40E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.22E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.26E-33 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 9.81E-08 mr1350 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.66E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 7.31E-06 7.32E-06 mr1370 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.77E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.75E-17 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 4.90E-07 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 3.14E-07 3.14E-07 mr1417 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 6.68E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 8.13E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 2.09E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 6.79E-06 6.79E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 5.40E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.46E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 8.50E-07 4.12E-38 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 2.57E-06 2.56E-06 mr1659 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.18E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.50E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 5.97E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 5.22E-06 NA mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 6.63E-07 7.62E-07 mr1909 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 2.78E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 9.26E-08 1.39E-06 mr1960 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215548475 NA 1.28E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251