Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215527241:

Variant ID: vg1215527241 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15527241
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGATTTTTCTCGATATTCTTGGGTTTTCTTTATGGCAACTAAGGACGAAGCTTTTCAACACTTCCGTGGTTTGTTTCTTCGATTGGAGCTTGAGTTTC[A/C]
AGGTTCTTTGAAAAGAATTCGAAGTGATAATGGTAGAGAGTTTAAAAATGCTTCATTTGAACAATTTTGCAATGAAAGAGGTCTTGAACATGAATTTTCT

Reverse complement sequence

AGAAAATTCATGTTCAAGACCTCTTTCATTGCAAAATTGTTCAAATGAAGCATTTTTAAACTCTCTACCATTATCACTTCGAATTCTTTTCAAAGAACCT[T/G]
GAAACTCAAGCTCCAATCGAAGAAACAAACCACGGAAGTGTTGAAAAGCTTCGTCCTTAGTTGCCATAAAGAAAACCCAAGAATATCGAGAAAAATCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 22.60% 0.66% 17.05% NA
All Indica  2759 87.60% 2.90% 1.01% 8.48% NA
All Japonica  1512 12.40% 60.80% 0.07% 26.65% NA
Aus  269 53.50% 8.60% 0.74% 37.17% NA
Indica I  595 94.10% 1.00% 0.00% 4.87% NA
Indica II  465 67.10% 5.40% 1.29% 26.24% NA
Indica III  913 94.50% 0.80% 1.42% 3.29% NA
Indica Intermediate  786 86.60% 5.50% 1.15% 6.74% NA
Temperate Japonica  767 4.60% 91.90% 0.00% 3.52% NA
Tropical Japonica  504 22.80% 11.90% 0.20% 65.08% NA
Japonica Intermediate  241 15.80% 64.30% 0.00% 19.92% NA
VI/Aromatic  96 32.30% 13.50% 0.00% 54.17% NA
Intermediate  90 48.90% 32.20% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215527241 A -> C LOC_Os12g26560.1 intron_variant ; MODIFIER silent_mutation Average:13.076; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg1215527241 A -> DEL N N silent_mutation Average:13.076; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215527241 1.17E-09 1.16E-15 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 5.69E-08 3.49E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 9.16E-08 9.36E-15 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 2.33E-07 1.80E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 7.40E-10 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 6.43E-09 6.10E-16 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 8.92E-08 5.79E-16 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 4.29E-07 2.02E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 5.23E-07 3.35E-15 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 1.07E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 9.09E-12 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 1.24E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 6.29E-06 6.29E-06 mr1184 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 1.83E-08 4.10E-16 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 2.44E-07 3.00E-15 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 2.13E-08 5.34E-16 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 2.18E-07 1.60E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 5.08E-07 5.08E-07 mr1663 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 1.04E-06 1.26E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 6.60E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 1.55E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 4.20E-06 6.13E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 7.39E-11 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 4.09E-08 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 1.84E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 3.52E-08 5.02E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 1.10E-07 3.38E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 4.62E-10 1.26E-19 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 1.40E-07 1.33E-17 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 1.43E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 9.05E-10 1.14E-18 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 2.15E-07 1.50E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 6.93E-10 7.73E-19 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 3.55E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 NA 5.42E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215527241 9.58E-06 NA mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251