Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215498700:

Variant ID: vg1215498700 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15498700
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCTGAGCCGCCAGCCGCCGCCCACTCGGAGGGAGAGAGATCGAAGGAGAGTGAGGGGAGAGCGAGAGGAGAGAAATAAATATCTGGAGAGGGAGAGAGA[T/G]
AGAGTAGACGGGTGAAAATTTCGATACCTATAGATTATGCCAATGCACTAGATTATCCCCTACATATAAAAATTACATCAAAGTATTAGATTTTTGACGG

Reverse complement sequence

CCGTCAAAAATCTAATACTTTGATGTAATTTTTATATGTAGGGGATAATCTAGTGCATTGGCATAATCTATAGGTATCGAAATTTTCACCCGTCTACTCT[A/C]
TCTCTCTCCCTCTCCAGATATTTATTTCTCTCCTCTCGCTCTCCCCTCACTCTCCTTCGATCTCTCTCCCTCCGAGTGGGCGGCGGCTGGCGGCTCAGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	41.60%	0.68%	13.90%	NA
All Indica	2759	61.70%	32.50%	0.69%	5.04%	NA
All Japonica	1512	11.00%	63.80%	0.53%	24.67%	NA
Aus	269	52.80%	14.10%	0.74%	32.34%	NA
Indica I	595	86.40%	13.10%	0.50%	0.00%	NA
Indica II	465	64.50%	15.50%	1.72%	18.28%	NA
Indica III	913	42.60%	55.10%	0.44%	1.86%	NA
Indica Intermediate	786	63.60%	31.20%	0.51%	4.71%	NA
Temperate Japonica	767	3.80%	93.50%	0.13%	2.61%	NA
Tropical Japonica	504	22.20%	15.90%	1.39%	60.52%	NA
Japonica Intermediate	241	10.40%	69.70%	0.00%	19.92%	NA
VI/Aromatic	96	28.10%	21.90%	2.08%	47.92%	NA
Intermediate	90	38.90%	46.70%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215498700	T -> DEL	N	N	silent_mutation	Average:42.266; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1215498700	T -> G	LOC_Os12g26500.1	upstream_gene_variant ; 4429.0bp to feature; MODIFIER	silent_mutation	Average:42.266; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1215498700	T -> G	LOC_Os12g26520.1	upstream_gene_variant ; 1950.0bp to feature; MODIFIER	silent_mutation	Average:42.266; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1215498700	T -> G	LOC_Os12g26510.1	downstream_gene_variant ; 109.0bp to feature; MODIFIER	silent_mutation	Average:42.266; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1215498700	T -> G	LOC_Os12g26500-LOC_Os12g26510	intergenic_region ; MODIFIER	silent_mutation	Average:42.266; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215498700	NA	6.01E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	1.38E-06	5.79E-16	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	7.78E-06	2.48E-15	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	6.71E-07	7.39E-16	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	5.56E-06	8.61E-14	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	9.11E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	7.33E-16	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	3.27E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	6.29E-06	4.66E-16	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	2.15E-16	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	1.20E-06	1.80E-17	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	2.17E-17	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	5.92E-15	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	3.44E-06	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	1.78E-07	8.80E-17	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	1.49E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	2.76E-07	7.20E-08	mr1438	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	9.92E-16	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	1.43E-07	6.56E-17	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	6.05E-16	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	3.56E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	1.29E-13	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	9.61E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	2.98E-11	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	2.70E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	7.35E-13	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	8.03E-13	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	1.75E-21	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	7.23E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	3.24E-06	3.20E-19	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	4.92E-18	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	7.84E-19	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	5.25E-10	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	8.18E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	4.75E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	2.17E-16	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	4.29E-19	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	4.59E-17	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	3.12E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	7.33E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	9.08E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	3.69E-15	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215498700	NA	5.29E-11	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251