\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215476610:

Variant ID: vg1215476610 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15476610
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATAAAATTAAACGATAAGTACTTTATTCGGAAGGTGACAAGTTGTCGTAAACTTGTCATGGTTGCCGGTTTACGATTCTACATCGTAACATGAATTCC[G/C,A]
TTGGATACAATTATGTGACATGCGATTCTAACAAGAATTTAGTGAAATCGTCATGTATACTCTGTAAAGGTAGGAACTTAATTACCACTATCCTATATAA

Reverse complement sequence

TTATATAGGATAGTGGTAATTAAGTTCCTACCTTTACAGAGTATACATGACGATTTCACTAAATTCTTGTTAGAATCGCATGTCACATAATTGTATCCAA[C/G,T]
GGAATTCATGTTACGATGTAGAATCGTAAACCGGCAACCATGACAAGTTTACGACAACTTGTCACCTTCCGAATAAAGTACTTATCGTTTAATTTTATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 15.20% 0.23% 0.00% A: 0.02%
All Indica  2759 94.00% 5.90% 0.04% 0.00% A: 0.04%
All Japonica  1512 73.90% 25.80% 0.26% 0.00% NA
Aus  269 62.80% 36.10% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 78.10% 21.90% 0.00% 0.00% NA
Indica III  913 97.90% 2.00% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 94.30% 5.60% 0.13% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 35.70% 63.50% 0.79% 0.00% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 54.20% 1.04% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215476610 G -> C LOC_Os12g26480.1 upstream_gene_variant ; 1253.0bp to feature; MODIFIER silent_mutation Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg1215476610 G -> C LOC_Os12g26480.2 upstream_gene_variant ; 1253.0bp to feature; MODIFIER silent_mutation Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg1215476610 G -> C LOC_Os12g26480-LOC_Os12g26500 intergenic_region ; MODIFIER silent_mutation Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg1215476610 G -> A LOC_Os12g26480.1 upstream_gene_variant ; 1253.0bp to feature; MODIFIER silent_mutation Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg1215476610 G -> A LOC_Os12g26480.2 upstream_gene_variant ; 1253.0bp to feature; MODIFIER silent_mutation Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg1215476610 G -> A LOC_Os12g26480-LOC_Os12g26500 intergenic_region ; MODIFIER silent_mutation Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215476610 NA 8.14E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 8.18E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 1.28E-07 2.84E-09 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 3.98E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 8.41E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 1.80E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 4.82E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 8.94E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 4.44E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 3.50E-06 4.97E-14 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 7.46E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 1.25E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215476610 NA 7.39E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251