\
| Variant ID: vg1215476610 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15476610 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAATAAAATTAAACGATAAGTACTTTATTCGGAAGGTGACAAGTTGTCGTAAACTTGTCATGGTTGCCGGTTTACGATTCTACATCGTAACATGAATTCC[G/C,A]
TTGGATACAATTATGTGACATGCGATTCTAACAAGAATTTAGTGAAATCGTCATGTATACTCTGTAAAGGTAGGAACTTAATTACCACTATCCTATATAA
TTATATAGGATAGTGGTAATTAAGTTCCTACCTTTACAGAGTATACATGACGATTTCACTAAATTCTTGTTAGAATCGCATGTCACATAATTGTATCCAA[C/G,T]
GGAATTCATGTTACGATGTAGAATCGTAAACCGGCAACCATGACAAGTTTACGACAACTTGTCACCTTCCGAATAAAGTACTTATCGTTTAATTTTATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 15.20% | 0.23% | 0.00% | A: 0.02% |
| All Indica | 2759 | 94.00% | 5.90% | 0.04% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 73.90% | 25.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 62.80% | 36.10% | 1.12% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.00% | 0.00% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 94.30% | 5.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 35.70% | 63.50% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 54.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215476610 | G -> C | LOC_Os12g26480.1 | upstream_gene_variant ; 1253.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg1215476610 | G -> C | LOC_Os12g26480.2 | upstream_gene_variant ; 1253.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg1215476610 | G -> C | LOC_Os12g26480-LOC_Os12g26500 | intergenic_region ; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg1215476610 | G -> A | LOC_Os12g26480.1 | upstream_gene_variant ; 1253.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg1215476610 | G -> A | LOC_Os12g26480.2 | upstream_gene_variant ; 1253.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg1215476610 | G -> A | LOC_Os12g26480-LOC_Os12g26500 | intergenic_region ; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215476610 | NA | 8.14E-08 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 8.18E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | 1.28E-07 | 2.84E-09 | mr1231 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 3.98E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 8.41E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 1.80E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 4.82E-08 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 8.94E-09 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 4.44E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | 3.50E-06 | 4.97E-14 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 7.46E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 1.25E-12 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215476610 | NA | 7.39E-12 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |