\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215471234:

Variant ID: vg1215471234 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15471234
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTTGTTATCTTCCCATTTGGTTTTCTCATATGTATTGATCAATTACATATGTATCTTCTAATCTGCTCAGGTATGATTTGGTTGAAAATGATAAATC[C/T]
AGGCAGCTTCCATGTGACTAATTTTTCGTAGGCTGTTGGTCCGGAATATATTAGTGAAATCATCTAAAAAATTATTGGAAATTTTACACATAGATATCAA

Reverse complement sequence

TTGATATCTATGTGTAAAATTTCCAATAATTTTTTAGATGATTTCACTAATATATTCCGGACCAACAGCCTACGAAAAATTAGTCACATGGAAGCTGCCT[G/A]
GATTTATCATTTTCAACCAAATCATACCTGAGCAGATTAGAAGATACATATGTAATTGATCAATACATATGAGAAAACCAAATGGGAAGATAACAAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 15.40% 1.82% 2.39% NA
All Indica  2759 87.20% 5.90% 2.86% 4.02% NA
All Japonica  1512 73.70% 25.90% 0.33% 0.07% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 63.00% 21.90% 9.89% 5.16% NA
Indica III  913 90.90% 2.00% 0.66% 6.46% NA
Indica Intermediate  786 87.50% 5.50% 3.44% 3.56% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 35.10% 63.90% 0.79% 0.20% NA
Japonica Intermediate  241 78.80% 20.70% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 54.20% 1.04% 0.00% NA
Intermediate  90 76.70% 21.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215471234 C -> DEL N N silent_mutation Average:37.173; most accessible tissue: Callus, score: 80.528 N N N N
vg1215471234 C -> T LOC_Os12g26480.1 downstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:37.173; most accessible tissue: Callus, score: 80.528 N N N N
vg1215471234 C -> T LOC_Os12g26480.2 downstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:37.173; most accessible tissue: Callus, score: 80.528 N N N N
vg1215471234 C -> T LOC_Os12g26470-LOC_Os12g26480 intergenic_region ; MODIFIER silent_mutation Average:37.173; most accessible tissue: Callus, score: 80.528 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215471234 NA 2.80E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 1.56E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 6.21E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 7.71E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 1.56E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 3.80E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 5.49E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 2.68E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 3.52E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 6.23E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 4.10E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 2.19E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 7.18E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 4.13E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 1.04E-08 1.33E-17 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 4.88E-07 1.89E-13 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 1.05E-09 4.35E-18 mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 6.52E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 3.96E-08 4.98E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 5.64E-08 2.04E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 2.42E-06 1.82E-15 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 3.42E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 2.54E-09 1.03E-18 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 8.10E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 2.57E-09 3.82E-17 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215471234 NA 6.37E-08 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251