\
| Variant ID: vg1215465887 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15465887 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )
ACGTGCTGATGTCAAATGTATACATCATGAAATAATTTTTGTATTTATAGCAGACAAATTGGTATTTCGTAATATTTATAGGTGTGAAATGGAACTTCCA[C/T]
TACGGAAGTATCTACTGCGCCATTCACATATCAGCTATCGTCGTCAAATTTCGAAAGATTCAGAAATAACTGTAGAGGATGTTCACGAGACACATGTTAT
ATAACATGTGTCTCGTGAACATCCTCTACAGTTATTTCTGAATCTTTCGAAATTTGACGACGATAGCTGATATGTGAATGGCGCAGTAGATACTTCCGTA[G/A]
TGGAAGTTCCATTTCACACCTATAAATATTACGAAATACCAATTTGTCTGCTATAAATACAAAAATTATTTCATGATGTATACATTTGACATCAGCACGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 15.40% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 5.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 73.90% | 25.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 62.50% | 36.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.40% | 22.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 35.70% | 63.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215465887 | C -> T | LOC_Os12g26470.1 | upstream_gene_variant ; 2622.0bp to feature; MODIFIER | silent_mutation | Average:40.927; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg1215465887 | C -> T | LOC_Os12g26470-LOC_Os12g26480 | intergenic_region ; MODIFIER | silent_mutation | Average:40.927; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215465887 | NA | 3.86E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 1.23E-08 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | 9.56E-07 | NA | mr1231 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 2.58E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 5.72E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 1.54E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 9.76E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 4.02E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 5.83E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215465887 | NA | 3.03E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |