Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215438933:

Variant ID: vg1215438933 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15438933
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAATTACACAGTTTGCATGTAAATTGCAAGCCGAATCTTTTGAGCCTAATTACGTCATGATTTAGCAATATGATGCTACAGTAAACATTTGTTAATGAC[G/A]
AATTAATTAGGCTTAATAGATTCGTCTCGCAGTTTACAGGCAGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATATGTGTCTATA

Reverse complement sequence

TATAGACACATATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCTGCCTGTAAACTGCGAGACGAATCTATTAAGCCTAATTAATT[C/T]
GTCATTAACAAATGTTTACTGTAGCATCATATTGCTAAATCATGACGTAATTAGGCTCAAAAGATTCGGCTTGCAATTTACATGCAAACTGTGTAATTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	5.20%	3.20%	35.00%	NA
All Indica	2759	60.20%	0.90%	3.30%	35.59%	NA
All Japonica	1512	61.60%	8.30%	2.12%	27.98%	NA
Aus	269	8.20%	29.70%	5.58%	56.51%	NA
Indica I	595	81.80%	0.20%	3.03%	14.96%	NA
Indica II	465	65.40%	0.20%	3.01%	31.40%	NA
Indica III	913	39.00%	1.00%	3.61%	56.41%	NA
Indica Intermediate	786	65.40%	1.80%	3.31%	29.52%	NA
Temperate Japonica	767	92.70%	0.30%	0.65%	6.39%	NA
Tropical Japonica	504	13.30%	23.80%	3.57%	59.33%	NA
Japonica Intermediate	241	63.50%	1.70%	3.73%	31.12%	NA
VI/Aromatic	96	14.60%	3.10%	5.21%	77.08%	NA
Intermediate	90	52.20%	13.30%	8.89%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215438933	G -> DEL	N	N	silent_mutation	Average:19.02; most accessible tissue: Callus, score: 59.093	N	N	N	N
vg1215438933	G -> A	LOC_Os12g26410.1	upstream_gene_variant ; 4454.0bp to feature; MODIFIER	silent_mutation	Average:19.02; most accessible tissue: Callus, score: 59.093	N	N	N	N
vg1215438933	G -> A	LOC_Os12g26420.1	downstream_gene_variant ; 1427.0bp to feature; MODIFIER	silent_mutation	Average:19.02; most accessible tissue: Callus, score: 59.093	N	N	N	N
vg1215438933	G -> A	LOC_Os12g26410-LOC_Os12g26420	intergenic_region ; MODIFIER	silent_mutation	Average:19.02; most accessible tissue: Callus, score: 59.093	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215438933	1.73E-06	NA	mr1016	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	6.12E-08	NA	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	5.19E-07	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	9.13E-07	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	3.04E-06	NA	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	5.82E-06	NA	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	7.19E-06	NA	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	9.86E-06	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	9.36E-09	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	4.48E-06	NA	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	1.46E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	1.50E-06	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	1.10E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	7.57E-06	NA	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	1.37E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	2.83E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	4.05E-07	NA	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	7.05E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	8.79E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	3.76E-06	NA	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	8.40E-07	NA	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	7.65E-06	NA	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	1.09E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	6.21E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	6.68E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	5.93E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	4.88E-06	NA	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	5.70E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	6.10E-09	NA	mr1019_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	6.67E-07	NA	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	5.93E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	6.03E-08	NA	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	3.74E-09	NA	mr1055_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	5.66E-10	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	4.64E-07	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	5.13E-09	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	5.46E-10	NA	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	1.55E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	1.31E-06	NA	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	NA	3.02E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	1.86E-09	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	3.09E-07	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	1.26E-06	NA	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438933	8.47E-10	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251