\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215434951:

Variant ID: vg1215434951 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15434951
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTGCTTGGATATTTTTTCCAAGCTATTTGATAAACTATGAAGGTAGCCTACATATTCACGCGAGCACGTATTGTAGCCTGCGTTTGAAAATCATATAT[A/G,T]
GGTGAAATATTAACTAGACCTGTCATGTTTCAAAAGTACTATTTCCTCATAAATTTTCTTCAAGGAAATTGCTTTGTTAATGTTTTTCAATAAATTTGTT

Reverse complement sequence

AACAAATTTATTGAAAAACATTAACAAAGCAATTTCCTTGAAGAAAATTTATGAGGAAATAGTACTTTTGAAACATGACAGGTCTAGTTAATATTTCACC[T/C,A]
ATATATGATTTTCAAACGCAGGCTACAATACGTGCTCGCGTGAATATGTAGGCTACCTTCATAGTTTATCAAATAGCTTGGAAAAAATATCCAAGCAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.30% 0.25% 0.00% T: 0.11%
All Indica  2759 67.30% 32.30% 0.22% 0.00% T: 0.18%
All Japonica  1512 69.20% 30.70% 0.07% 0.00% NA
Aus  269 7.40% 92.20% 0.37% 0.00% NA
Indica I  595 81.00% 19.00% 0.00% 0.00% NA
Indica II  465 69.00% 30.10% 0.86% 0.00% NA
Indica III  913 53.30% 46.00% 0.11% 0.00% T: 0.55%
Indica Intermediate  786 72.30% 27.60% 0.13% 0.00% NA
Temperate Japonica  767 92.60% 7.40% 0.00% 0.00% NA
Tropical Japonica  504 35.70% 64.10% 0.20% 0.00% NA
Japonica Intermediate  241 65.10% 34.90% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215434951 A -> G LOC_Os12g26410.1 upstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:36.475; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1215434951 A -> G LOC_Os12g26400.1 downstream_gene_variant ; 4204.0bp to feature; MODIFIER silent_mutation Average:36.475; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1215434951 A -> G LOC_Os12g26410-LOC_Os12g26420 intergenic_region ; MODIFIER silent_mutation Average:36.475; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1215434951 A -> T LOC_Os12g26410.1 upstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:36.475; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1215434951 A -> T LOC_Os12g26400.1 downstream_gene_variant ; 4204.0bp to feature; MODIFIER silent_mutation Average:36.475; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg1215434951 A -> T LOC_Os12g26410-LOC_Os12g26420 intergenic_region ; MODIFIER silent_mutation Average:36.475; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215434951 2.02E-09 5.08E-21 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.81E-08 5.44E-20 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 7.33E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 9.09E-09 8.86E-20 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 4.27E-08 4.69E-17 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.11E-06 7.85E-14 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.37E-07 6.49E-23 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 8.55E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.23E-10 3.32E-23 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 5.45E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 9.34E-09 2.32E-24 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 8.41E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 3.11E-11 2.90E-25 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 7.40E-09 7.11E-25 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 6.49E-07 5.13E-19 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 2.20E-12 9.78E-26 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 9.17E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 2.60E-08 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 3.24E-09 1.55E-24 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 3.11E-12 2.09E-25 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.28E-08 5.44E-24 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 2.90E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 5.31E-09 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 8.29E-09 1.29E-22 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 6.61E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 2.98E-06 7.00E-15 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 3.71E-08 3.11E-19 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 2.02E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 5.78E-14 1.57E-36 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 4.28E-09 9.59E-19 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 9.10E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.02E-10 3.85E-30 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.57E-07 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 3.70E-10 3.51E-27 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 2.59E-08 7.45E-25 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 2.88E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.89E-07 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 6.15E-06 1.05E-13 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 3.74E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 1.48E-10 2.71E-26 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 4.06E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 2.40E-09 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 6.85E-10 4.80E-30 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 8.19E-11 4.94E-27 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 3.84E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 1.39E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 6.47E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 2.05E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 5.12E-09 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 3.65E-07 9.12E-24 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 5.87E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 5.96E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 1.26E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215434951 NA 4.91E-11 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251