\
| Variant ID: vg1215431363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15431363 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.03, others allele: 0.00, population size: 111. )
TTAAAAAATTCTCTTGGTTATTTTGTGCTAGAGGTTATTTGAGAAAGAGTGATAAATGCAATAGGTATATGTGTTTCGTGTTTATTCTTCAACGTATGTG[C/G]
TTGTTAAGATGTTGCATTATAAATCGTATGAAATCACGAATTTTGATTGTTGATTCAAGCTTAATTGTAAAATCTTTGGTTCATGGTTATACTTTAATTC
GAATTAAAGTATAACCATGAACCAAAGATTTTACAATTAAGCTTGAATCAACAATCAAAATTCGTGATTTCATACGATTTATAATGCAACATCTTAACAA[G/C]
CACATACGTTGAAGAATAAACACGAAACACATATACCTATTGCATTTATCACTCTTTCTCAAATAACCTCTAGCACAAAATAACCAAGAGAATTTTTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 23.10% | 4.13% | 40.12% | NA |
| All Indica | 2759 | 54.30% | 5.00% | 4.02% | 36.72% | NA |
| All Japonica | 1512 | 1.50% | 59.60% | 0.40% | 38.56% | NA |
| Aus | 269 | 0.70% | 7.10% | 24.16% | 68.03% | NA |
| Indica I | 595 | 77.80% | 3.70% | 1.34% | 17.14% | NA |
| Indica II | 465 | 60.40% | 4.30% | 1.51% | 33.76% | NA |
| Indica III | 913 | 34.10% | 4.30% | 7.45% | 54.22% | NA |
| Indica Intermediate | 786 | 56.20% | 7.30% | 3.56% | 32.95% | NA |
| Temperate Japonica | 767 | 1.00% | 91.30% | 0.26% | 7.43% | NA |
| Tropical Japonica | 504 | 1.80% | 10.70% | 0.60% | 86.90% | NA |
| Japonica Intermediate | 241 | 2.10% | 61.00% | 0.41% | 36.51% | NA |
| VI/Aromatic | 96 | 2.10% | 10.40% | 4.17% | 83.33% | NA |
| Intermediate | 90 | 21.10% | 27.80% | 10.00% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215431363 | C -> DEL | N | N | silent_mutation | Average:13.223; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg1215431363 | C -> G | LOC_Os12g26400.1 | downstream_gene_variant ; 616.0bp to feature; MODIFIER | silent_mutation | Average:13.223; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg1215431363 | C -> G | LOC_Os12g26410.1 | downstream_gene_variant ; 1585.0bp to feature; MODIFIER | silent_mutation | Average:13.223; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg1215431363 | C -> G | LOC_Os12g26400-LOC_Os12g26410 | intergenic_region ; MODIFIER | silent_mutation | Average:13.223; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215431363 | 1.52E-06 | 6.98E-07 | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 2.87E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 4.95E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 1.48E-06 | mr1330 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | 4.55E-06 | 1.42E-07 | mr1438 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 5.78E-10 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 2.83E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 9.97E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | 2.34E-06 | 2.14E-07 | mr1579 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 4.32E-09 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | 4.62E-06 | 3.04E-06 | mr1626 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | 8.72E-06 | 1.82E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 4.52E-08 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 1.22E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | NA | 4.05E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215431363 | 9.12E-06 | 3.22E-12 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |