\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215359795:

Variant ID: vg1215359795 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15359795
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTCGCTCCATCTTCATTTCCAATTTTCCCGTCCTTTCCCCCTAAGTCCGACATCGTGGATCACTCAAAGCGGTGAAGCTTGAATCAAGAGCACCTCG[T/C]
TCTGATACCAATTGAACGCGCAGAGATATAGCCTAGAGGGGGGTGAATAGGCTTTCCTGAAATTTTCTCGACAATCGCAGTGGTTATAATAACAGGGCCC

Reverse complement sequence

GGGCCCTGTTATTATAACCACTGCGATTGTCGAGAAAATTTCAGGAAAGCCTATTCACCCCCCTCTAGGCTATATCTCTGCGCGTTCAATTGGTATCAGA[A/G]
CGAGGTGCTCTTGATTCAAGCTTCACCGCTTTGAGTGATCCACGATGTCGGACTTAGGGGGAAAGGACGGGAAAATTGGAAATGAAGATGGAGCGAGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.90% 4.70% 21.03% 51.46% NA
All Indica  2759 4.30% 1.70% 27.94% 66.00% NA
All Japonica  1512 59.50% 9.50% 3.57% 27.45% NA
Aus  269 8.20% 5.60% 55.76% 30.48% NA
Indica I  595 4.00% 3.20% 7.39% 85.38% NA
Indica II  465 4.90% 0.40% 26.67% 67.96% NA
Indica III  913 1.60% 1.10% 43.70% 53.56% NA
Indica Intermediate  786 7.40% 2.00% 25.95% 64.63% NA
Temperate Japonica  767 91.10% 0.30% 0.91% 7.69% NA
Tropical Japonica  504 10.50% 26.60% 7.74% 55.16% NA
Japonica Intermediate  241 61.40% 2.90% 3.32% 32.37% NA
VI/Aromatic  96 11.50% 0.00% 8.33% 80.21% NA
Intermediate  90 30.00% 16.70% 12.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215359795 T -> C LOC_Os12g26310.1 upstream_gene_variant ; 45.0bp to feature; MODIFIER silent_mutation Average:9.022; most accessible tissue: Callus, score: 34.603 N N N N
vg1215359795 T -> C LOC_Os12g26320.1 downstream_gene_variant ; 3315.0bp to feature; MODIFIER silent_mutation Average:9.022; most accessible tissue: Callus, score: 34.603 N N N N
vg1215359795 T -> C LOC_Os12g26310-LOC_Os12g26320 intergenic_region ; MODIFIER silent_mutation Average:9.022; most accessible tissue: Callus, score: 34.603 N N N N
vg1215359795 T -> DEL N N silent_mutation Average:9.022; most accessible tissue: Callus, score: 34.603 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215359795 NA 2.75E-36 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 3.79E-09 3.88E-34 mr1022 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 5.28E-60 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 1.18E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 1.45E-50 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 6.79E-65 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 5.02E-17 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 1.47E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 5.00E-64 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 3.74E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 5.37E-41 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 1.32E-71 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 8.87E-55 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 3.66E-34 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 6.65E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 2.65E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215359795 NA 4.28E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251