Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215354440:

Variant ID: vg1215354440 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15354440
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGCACTCTCATTGTCACAAAGGAGTGGGATCTTGGTGAAGTTATAGCCAAAGTCTTTTAGGGTTTGTTTCATCCAAAGGAGTTGGGCACAACAAGAACC[T/G]
GCCGCGACATATTTGGCTTCGGCGGTGGATAATGCAATAGAATTTTGCTTCTTGGAGGACCAAGAAACAAGGGACCGACCAAGAAATTGGCAAGTCCCGG

Reverse complement sequence

CCGGGACTTGCCAATTTCTTGGTCGGTCCCTTGTTTCTTGGTCCTCCAAGAAGCAAAATTCTATTGCATTATCCACCGCCGAAGCCAAATATGTCGCGGC[A/C]
GGTTCTTGTTGTGCCCAACTCCTTTGGATGAAACAAACCCTAAAAGACTTTGGCTATAACTTCACCAAGATCCCACTCCTTTGTGACAATGAGAGTGCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.80%	3.30%	7.36%	66.46%	NA
All Indica	2759	4.20%	0.50%	10.80%	84.45%	NA
All Japonica	1512	59.70%	8.50%	0.99%	30.89%	NA
Aus	269	8.20%	1.10%	11.90%	78.81%	NA
Indica I	595	3.90%	0.00%	2.69%	93.45%	NA
Indica II	465	5.20%	0.90%	7.74%	86.24%	NA
Indica III	913	1.50%	0.50%	18.84%	79.08%	NA
Indica Intermediate	786	7.00%	0.80%	9.41%	82.82%	NA
Temperate Japonica	767	91.40%	0.40%	0.39%	7.82%	NA
Tropical Japonica	504	10.50%	24.00%	0.99%	64.48%	NA
Japonica Intermediate	241	61.40%	1.70%	2.90%	34.02%	NA
VI/Aromatic	96	11.50%	0.00%	1.04%	87.50%	NA
Intermediate	90	31.10%	13.30%	2.22%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215354440	T -> DEL	LOC_Os12g26310.1	N	frameshift_variant	Average:10.093; most accessible tissue: Callus, score: 31.366	N	N	N	N
vg1215354440	T -> G	LOC_Os12g26310.1	splice_region_variant&synonymous_variant ; p.Ala1444Ala; LOW	synonymous_codon	Average:10.093; most accessible tissue: Callus, score: 31.366	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215354440	NA	1.30E-34	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	1.32E-29	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	7.94E-47	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	7.64E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	5.53E-61	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	3.98E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	3.44E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	4.82E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	7.08E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	2.52E-09	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	5.43E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	1.19E-37	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	2.36E-70	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	2.17E-54	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	5.21E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	4.64E-21	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	2.61E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	6.85E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	2.56E-17	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	1.56E-18	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	7.94E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	2.92E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	7.40E-15	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	4.97E-06	7.52E-19	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	8.83E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	3.53E-06	2.27E-06	mr1815_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	9.71E-07	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	NA	5.14E-12	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354440	7.68E-06	NA	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251