\
| Variant ID: vg1215354257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15354257 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTCCTAAGCTCGCAAAATCTTTTCTCGTCTAAGGGCTTGGTGAAAATGTCGGCCAATTGGCTCTCGGTTTCTCACATGTGTAAGGCAAATGTCTCCTTT[G/A]
GTCTCATGATCTCTCAAAAAGTGATGGCGAATATCTATGTGTTTGGTTCGAGAATGTTGAACGGGATTATTGGCTATTTTGATGGCACTCTCATTGTCAC
GTGACAATGAGAGTGCCATCAAAATAGCCAATAATCCCGTTCAACATTCTCGAACCAAACACATAGATATTCGCCATCACTTTTTGAGAGATCATGAGAC[C/T]
AAAGGAGACATTTGCCTTACACATGTGAGAAACCGAGAGCCAATTGGCCGACATTTTCACCAAGCCCTTAGACGAGAAAAGATTTTGCGAGCTTAGGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 1.90% | 24.67% | 29.75% | NA |
| All Indica | 2759 | 26.90% | 3.30% | 37.98% | 31.90% | NA |
| All Japonica | 1512 | 69.80% | 0.00% | 3.44% | 26.72% | NA |
| Aus | 269 | 71.00% | 0.70% | 14.13% | 14.13% | NA |
| Indica I | 595 | 6.70% | 3.90% | 30.59% | 58.82% | NA |
| Indica II | 465 | 17.40% | 4.90% | 36.99% | 40.65% | NA |
| Indica III | 913 | 42.80% | 1.50% | 45.24% | 10.41% | NA |
| Indica Intermediate | 786 | 29.10% | 3.80% | 35.75% | 31.30% | NA |
| Temperate Japonica | 767 | 91.80% | 0.00% | 1.17% | 7.04% | NA |
| Tropical Japonica | 504 | 39.10% | 0.00% | 6.94% | 53.97% | NA |
| Japonica Intermediate | 241 | 64.30% | 0.00% | 3.32% | 32.37% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 15.62% | 63.54% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 14.44% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215354257 | G -> DEL | N | N | silent_mutation | Average:10.848; most accessible tissue: Callus, score: 40.55 | N | N | N | N |
| vg1215354257 | G -> A | LOC_Os12g26310.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.848; most accessible tissue: Callus, score: 40.55 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215354257 | NA | 1.04E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | 2.46E-06 | NA | mr1136_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 5.34E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 2.28E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 1.09E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 4.17E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | 6.32E-06 | 6.32E-06 | mr1407_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | 2.36E-06 | 2.36E-06 | mr1511_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 7.61E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 7.49E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 3.85E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 5.34E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215354257 | NA | 1.70E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |