\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215352883:

Variant ID: vg1215352883 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15352883
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGTCCCTTCTGCACTTGGCAAGCTAATGAAGGTAGTTGGACTTGGGTCTTCCAATATGGTGCATAGGAGTGGTGTCAAAACCAATAGTCTTGTAGAG[C/A]
CGAACGGGATTCTCACAAGATCCAACAGGGAAATCATGAGAGGCCCTTCCAGCCCCAGAAGAGCGACCACCACCTCTCCCACGACCTCTTGAAGAAGAAG

Reverse complement sequence

CTTCTTCTTCAAGAGGTCGTGGGAGAGGTGGTGGTCGCTCTTCTGGGGCTGGAAGGGCCTCTCATGATTTCCCTGTTGGATCTTGTGAGAATCCCGTTCG[G/T]
CTCTACAAGACTATTGGTTTTGACACCACTCCTATGCACCATATTGGAAGACCCAAGTCCAACTACCTTCATTAGCTTGCCAAGTGCAGAAGGGACCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 1.10% 2.77% 7.79% NA
All Indica  2759 96.20% 0.90% 1.56% 1.34% NA
All Japonica  1512 80.50% 0.70% 0.53% 18.32% NA
Aus  269 63.90% 5.90% 27.88% 2.23% NA
Indica I  595 96.30% 1.50% 2.02% 0.17% NA
Indica II  465 96.10% 0.20% 0.86% 2.80% NA
Indica III  913 97.80% 0.70% 0.77% 0.77% NA
Indica Intermediate  786 94.40% 1.00% 2.54% 2.04% NA
Temperate Japonica  767 94.40% 0.00% 0.13% 5.48% NA
Tropical Japonica  504 60.70% 2.00% 0.60% 36.71% NA
Japonica Intermediate  241 77.60% 0.00% 1.66% 20.75% NA
VI/Aromatic  96 53.10% 0.00% 3.12% 43.75% NA
Intermediate  90 87.80% 3.30% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215352883 C -> DEL LOC_Os12g26310.1 N frameshift_variant Average:10.336; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1215352883 C -> A LOC_Os12g26310.1 synonymous_variant ; p.Arg1550Arg; LOW synonymous_codon Average:10.336; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215352883 NA 6.49E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 2.31E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 2.50E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 1.91E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 1.32E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 3.49E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 8.80E-06 8.80E-06 mr1357 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 9.97E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 4.32E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 1.34E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 2.97E-06 2.96E-06 mr1421 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 2.45E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 4.75E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 5.93E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 9.17E-07 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 1.22E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 5.82E-07 1.13E-08 mr1651 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 6.52E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 4.46E-06 4.47E-06 mr1674 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 8.13E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 7.20E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 NA 4.08E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352883 2.77E-06 2.77E-06 mr1823 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251