Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215352870:

Variant ID: vg1215352870 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15352870
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGGATCAATCAATCGGTCCCTTCTGCACTTGGCAAGCTAATGAAGGTAGTTGGACTTGGGTCTTCCAATATGGTGCATAGGAGTGGTGTCAAAACCAA[T/G]
AGTCTTGTAGAGCCGAACGGGATTCTCACAAGATCCAACAGGGAAATCATGAGAGGCCCTTCCAGCCCCAGAAGAGCGACCACCACCTCTCCCACGACCT

Reverse complement sequence

AGGTCGTGGGAGAGGTGGTGGTCGCTCTTCTGGGGCTGGAAGGGCCTCTCATGATTTCCCTGTTGGATCTTGTGAGAATCCCGTTCGGCTCTACAAGACT[A/C]
TTGGTTTTGACACCACTCCTATGCACCATATTGGAAGACCCAAGTCCAACTACCTTCATTAGCTTGCCAAGTGCAGAAGGGACCGATTGATTGATCCAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 0.70% 2.50% 7.79% NA
All Indica  2759 96.40% 0.70% 1.52% 1.38% NA
All Japonica  1512 80.70% 0.50% 0.60% 18.25% NA
Aus  269 71.40% 2.60% 23.79% 2.23% NA
Indica I  595 96.30% 1.30% 2.18% 0.17% NA
Indica II  465 96.10% 0.20% 0.86% 2.80% NA
Indica III  913 98.20% 0.30% 0.66% 0.77% NA
Indica Intermediate  786 94.50% 0.90% 2.42% 2.16% NA
Temperate Japonica  767 94.40% 0.00% 0.13% 5.48% NA
Tropical Japonica  504 60.90% 1.40% 0.99% 36.71% NA
Japonica Intermediate  241 78.40% 0.00% 1.24% 20.33% NA
VI/Aromatic  96 56.20% 0.00% 0.00% 43.75% NA
Intermediate  90 87.80% 2.20% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215352870 T -> DEL LOC_Os12g26310.1 N frameshift_variant Average:10.796; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215352870 T -> G LOC_Os12g26310.1 missense_variant ; p.Ile1555Leu; MODERATE nonsynonymous_codon ; I1555L Average:10.796; most accessible tissue: Minghui63 panicle, score: 29.741 benign -0.47 TOLERATED 0.41

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215352870 NA 6.73E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 3.27E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 2.70E-06 3.81E-10 mr1207 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.69E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 1.28E-06 1.28E-06 mr1214 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 7.44E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 2.28E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 6.58E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 4.73E-07 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 6.46E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 9.20E-06 2.32E-07 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 8.03E-06 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 2.62E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.08E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 3.51E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.60E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 2.42E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 6.25E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.67E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 3.53E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 4.82E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 3.09E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 2.40E-06 mr1469 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 5.71E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 4.04E-07 2.47E-07 mr1511 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 9.97E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 2.46E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 4.00E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 2.45E-06 mr1635 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 1.32E-06 4.11E-08 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 6.95E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.63E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.45E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.76E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 7.56E-07 7.55E-07 mr1823 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 5.05E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 1.18E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 2.89E-06 NA mr1943 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 NA 8.49E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870 2.04E-06 2.04E-06 mr1953 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251