Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215352870:

Variant ID: vg1215352870 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15352870
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTGGATCAATCAATCGGTCCCTTCTGCACTTGGCAAGCTAATGAAGGTAGTTGGACTTGGGTCTTCCAATATGGTGCATAGGAGTGGTGTCAAAACCAA[T/G]
AGTCTTGTAGAGCCGAACGGGATTCTCACAAGATCCAACAGGGAAATCATGAGAGGCCCTTCCAGCCCCAGAAGAGCGACCACCACCTCTCCCACGACCT

Reverse complement sequence

AGGTCGTGGGAGAGGTGGTGGTCGCTCTTCTGGGGCTGGAAGGGCCTCTCATGATTTCCCTGTTGGATCTTGTGAGAATCCCGTTCGGCTCTACAAGACT[A/C]
TTGGTTTTGACACCACTCCTATGCACCATATTGGAAGACCCAAGTCCAACTACCTTCATTAGCTTGCCAAGTGCAGAAGGGACCGATTGATTGATCCAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	0.70%	2.50%	7.79%	NA
All Indica	2759	96.40%	0.70%	1.52%	1.38%	NA
All Japonica	1512	80.70%	0.50%	0.60%	18.25%	NA
Aus	269	71.40%	2.60%	23.79%	2.23%	NA
Indica I	595	96.30%	1.30%	2.18%	0.17%	NA
Indica II	465	96.10%	0.20%	0.86%	2.80%	NA
Indica III	913	98.20%	0.30%	0.66%	0.77%	NA
Indica Intermediate	786	94.50%	0.90%	2.42%	2.16%	NA
Temperate Japonica	767	94.40%	0.00%	0.13%	5.48%	NA
Tropical Japonica	504	60.90%	1.40%	0.99%	36.71%	NA
Japonica Intermediate	241	78.40%	0.00%	1.24%	20.33%	NA
VI/Aromatic	96	56.20%	0.00%	0.00%	43.75%	NA
Intermediate	90	87.80%	2.20%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215352870	T -> DEL	LOC_Os12g26310.1	N	frameshift_variant	Average:10.796; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1215352870	T -> G	LOC_Os12g26310.1	missense_variant ; p.Ile1555Leu; MODERATE	nonsynonymous_codon ; I1555L	Average:10.796; most accessible tissue: Minghui63 panicle, score: 29.741	benign	-0.47	TOLERATED	0.41

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215352870	NA	6.73E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	3.27E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	2.70E-06	3.81E-10	mr1207	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.69E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	1.28E-06	1.28E-06	mr1214	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	7.44E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	2.28E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	6.58E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	4.73E-07	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	6.46E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	9.20E-06	2.32E-07	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	8.03E-06	mr1284	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	2.62E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.08E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	3.51E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.60E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	2.42E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	6.25E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.67E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	3.53E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	4.82E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	3.09E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	2.40E-06	mr1469	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	5.71E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	4.04E-07	2.47E-07	mr1511	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	9.97E-07	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	2.46E-06	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	4.00E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	2.45E-06	mr1635	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	1.32E-06	4.11E-08	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	6.95E-08	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.63E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.45E-06	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.76E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	7.56E-07	7.55E-07	mr1823	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	5.05E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	1.18E-07	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	2.89E-06	NA	mr1943	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	NA	8.49E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215352870	2.04E-06	2.04E-06	mr1953	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251