\
| Variant ID: vg1215306171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15306171 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTGGGCACCTCAAATCCTTGCGGGTATGGGACTGAATCTACATATTCAGGATACGGCCTTTGATATGTATGCATAACTACTTTGGATTCTATTGCACCA[C/A]
TATCCCGCAAGACATTGTCATCATCTTTTCTAACATCCACATGACCGATTTGTGATTCGATCTTAGGTGACAATGCTATTTCACTTTCGCTTGTGGTACA
TGTACCACAAGCGAAAGTGAAATAGCATTGTCACCTAAGATCGAATCACAAATCGGTCATGTGGATGTTAGAAAAGATGATGACAATGTCTTGCGGGATA[G/T]
TGGTGCAATAGAATCCAAAGTAGTTATGCATACATATCAAAGGCCGTATCCTGAATATGTAGATTCAGTCCCATACCCGCAAGGATTTGAGGTGCCCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.80% | 0.00% | 2.69% | 28.52% | NA |
| All Indica | 2759 | 57.40% | 0.00% | 4.31% | 38.27% | NA |
| All Japonica | 1512 | 91.90% | 0.10% | 0.53% | 7.54% | NA |
| Aus | 269 | 48.00% | 0.00% | 0.00% | 52.04% | NA |
| Indica I | 595 | 42.50% | 0.00% | 9.24% | 48.24% | NA |
| Indica II | 465 | 85.20% | 0.00% | 1.29% | 13.55% | NA |
| Indica III | 913 | 49.70% | 0.00% | 4.38% | 45.89% | NA |
| Indica Intermediate | 786 | 61.20% | 0.00% | 2.29% | 36.51% | NA |
| Temperate Japonica | 767 | 97.40% | 0.00% | 0.26% | 2.35% | NA |
| Tropical Japonica | 504 | 83.30% | 0.00% | 0.60% | 16.07% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.40% | 1.24% | 6.22% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215306171 | C -> DEL | LOC_Os12g26260.1 | N | frameshift_variant | Average:21.107; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1215306171 | C -> A | LOC_Os12g26260.1 | missense_variant ; p.Ser392Ile; MODERATE | nonsynonymous_codon ; S392I | Average:21.107; most accessible tissue: Minghui63 panicle, score: 46.754 | unknown | unknown | DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215306171 | NA | 1.42E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 1.29E-10 | 2.82E-15 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 7.99E-09 | 1.33E-12 | mr1547 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 2.40E-10 | 4.25E-21 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 1.73E-08 | 7.89E-19 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 7.48E-07 | NA | mr1004_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 2.06E-06 | NA | mr1004_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | NA | 6.01E-07 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 4.52E-07 | 1.85E-11 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 8.20E-07 | 7.86E-11 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 3.66E-08 | 1.35E-30 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215306171 | 2.71E-06 | 5.80E-23 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |