\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215277151:

Variant ID: vg1215277151 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15277151
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCGGCATCGGCCTATGCAAGATGGAAATAAAAAATTCAGTAATTGTCCTATATTATGCAAGATAAATGAAATAATTGTAAGAACTAATACAAATTCGA[T/C]
GTACCCCCACGAAGTAGTCTCGGCCACGGTGCGTGGGATACGCACCCGTGACAGCGGCAACGTGCTGCTCTGGGGCGTCTGGAGTGAAGGTCACACGCGC

Reverse complement sequence

GCGCGTGTGACCTTCACTCCAGACGCCCCAGAGCAGCACGTTGCCGCTGTCACGGGTGCGTATCCCACGCACCGTGGCCGAGACTACTTCGTGGGGGTAC[A/G]
TCGAATTTGTATTAGTTCTTACAATTATTTCATTTATCTTGCATAATATAGGACAATTACTGAATTTTTTATTTCCATCTTGCATAGGCCGATGCCGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.10% 17.10% 11.66% 36.16% NA
All Indica  2759 6.20% 26.90% 8.19% 58.72% NA
All Japonica  1512 76.50% 3.80% 16.40% 3.31% NA
Aus  269 89.60% 0.00% 8.18% 2.23% NA
Indica I  595 4.90% 8.20% 6.39% 80.50% NA
Indica II  465 5.80% 55.90% 12.26% 26.02% NA
Indica III  913 4.60% 21.60% 7.56% 66.27% NA
Indica Intermediate  786 9.30% 30.00% 7.89% 52.80% NA
Temperate Japonica  767 93.70% 0.80% 3.65% 1.83% NA
Tropical Japonica  504 52.80% 9.50% 34.13% 3.57% NA
Japonica Intermediate  241 71.40% 1.20% 19.92% 7.47% NA
VI/Aromatic  96 41.70% 1.00% 42.71% 14.58% NA
Intermediate  90 55.60% 7.80% 15.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215277151 T -> C LOC_Os12g26204.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:16.792; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg1215277151 T -> C LOC_Os12g26190.1 downstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:16.792; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg1215277151 T -> DEL N N silent_mutation Average:16.792; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215277151 5.57E-06 NA mr1383 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215277151 3.00E-06 3.00E-06 mr1564 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215277151 NA 6.19E-06 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215277151 NA 9.66E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215277151 NA 6.39E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251