\
| Variant ID: vg1215271859 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15271859 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 263. )
GAAGGATCTTTTGAGACGGTTCAAGATGGAGAATTGCAAGCCAATTTCAACACCAATTGGTTCTACAGCTGTGTTAGATCCTGATGAAGATGGTGAAGCT[G/A]
TTGATCAAAAAGAGTATAGAAGTATGATTGGATCTTTGTTATATCTAACTGCTTCTAGGCCAGACATACAATTTGCTATGTGTTTGTGTGCACGCTTTCA
TGAAAGCGTGCACACAAACACATAGCAAATTGTATGTCTGGCCTAGAAGCAGTTAGATATAACAAAGATCCAATCATACTTCTATACTCTTTTTGATCAA[C/T]
AGCTTCACCATCTTCATCAGGATCTAACACAGCTGTAGAACCAATTGGTGTTGAAATTGGCTTGCAATTCTCCATCTTGAACCGTCTCAAAAGATCCTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 7.30% | 1.48% | 7.83% | NA |
| All Indica | 2759 | 85.60% | 1.60% | 0.87% | 11.85% | NA |
| All Japonica | 1512 | 91.70% | 3.00% | 2.84% | 2.38% | NA |
| Aus | 269 | 17.50% | 81.40% | 0.37% | 0.74% | NA |
| Indica I | 595 | 98.70% | 0.20% | 0.34% | 0.84% | NA |
| Indica II | 465 | 85.80% | 0.40% | 1.51% | 12.26% | NA |
| Indica III | 913 | 77.30% | 2.50% | 1.20% | 18.95% | NA |
| Indica Intermediate | 786 | 85.40% | 2.40% | 0.51% | 11.70% | NA |
| Temperate Japonica | 767 | 97.90% | 0.70% | 0.91% | 0.52% | NA |
| Tropical Japonica | 504 | 82.10% | 6.70% | 5.56% | 5.56% | NA |
| Japonica Intermediate | 241 | 92.10% | 2.90% | 3.32% | 1.66% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 8.90% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215271859 | G -> DEL | LOC_Os12g26190.1 | N | frameshift_variant | Average:8.162; most accessible tissue: Minghui63 young leaf, score: 13.864 | N | N | N | N |
| vg1215271859 | G -> A | LOC_Os12g26190.1 | missense_variant ; p.Val1064Ile; MODERATE | nonsynonymous_codon ; V1064I | Average:8.162; most accessible tissue: Minghui63 young leaf, score: 13.864 | benign |
0.807 |
TOLERATED | 0.18 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215271859 | NA | 4.50E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | NA | 1.70E-10 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | NA | 1.32E-10 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | NA | 3.34E-11 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | NA | 6.68E-06 | mr1790 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | NA | 1.28E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | 2.99E-06 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | 2.06E-06 | 3.04E-13 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | 7.45E-07 | 1.65E-14 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271859 | 1.90E-07 | 1.88E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |