\
| Variant ID: vg1215271479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15271479 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGTCAAACAACCACCAGGTTTTGAAAATCCTGATTTTCCCAACCATGTTTTTAAATTGTCTAAAGCTTTATATGGTTTGAAACAAGCTCCCAGGGCATGG[T/C]
ATGATAGGCTTAAGAACTTTTTGCTTGCAAAAGGTTTTTACAATGGGAAAGGTTGACAAAACGCTTTTTGTTTCTTAAGCATGGTGATAATCAACTTTTC
GAAAAGTTGATTATCACCATGCTTAAGAAACAAAAAGCGTTTTGTCAACCTTTCCCATTGTAAAAACCTTTTGCAAGCAAAAAGTTCTTAAGCCTATCAT[A/G]
CCATGCCCTGGGAGCTTGTTTCAAACCATATAAAGCTTTAGACAATTTAAAAACATGGTTGGGAAAATCAGGATTTTCAAAACCTGGTGGTTGTTTGACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.50% | 7.10% | 3.09% | 8.32% | NA |
| All Indica | 2759 | 84.80% | 0.60% | 3.41% | 11.16% | NA |
| All Japonica | 1512 | 73.00% | 18.90% | 3.04% | 5.03% | NA |
| Aus | 269 | 92.20% | 6.30% | 0.00% | 1.49% | NA |
| Indica I | 595 | 96.80% | 0.00% | 2.35% | 0.84% | NA |
| Indica II | 465 | 82.80% | 0.40% | 2.58% | 14.19% | NA |
| Indica III | 913 | 78.90% | 0.30% | 3.40% | 17.42% | NA |
| Indica Intermediate | 786 | 84.00% | 1.40% | 4.71% | 9.92% | NA |
| Temperate Japonica | 767 | 86.70% | 8.00% | 3.91% | 1.43% | NA |
| Tropical Japonica | 504 | 56.20% | 31.70% | 0.99% | 11.11% | NA |
| Japonica Intermediate | 241 | 64.70% | 27.00% | 4.56% | 3.73% | NA |
| VI/Aromatic | 96 | 91.70% | 6.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 13.30% | 4.44% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215271479 | T -> C | LOC_Os12g26190.1 | splice_donor_variant&intron_variant ; HIGH | splice_donor_variant | Average:7.847; most accessible tissue: Callus, score: 12.192 | N | N | N | N |
| vg1215271479 | T -> DEL | LOC_Os12g26190.1 | N | splice_donor_variant | Average:7.847; most accessible tissue: Callus, score: 12.192 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215271479 | 6.13E-07 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 2.67E-06 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 1.24E-07 | NA | mr1055 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 7.58E-07 | NA | mr1142 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 1.33E-07 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 7.84E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 2.09E-07 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 7.69E-10 | NA | mr1019_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 2.36E-08 | NA | mr1023_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 3.58E-07 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | NA | 8.39E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | NA | 6.82E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | NA | 8.76E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 3.41E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 1.51E-08 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215271479 | 6.61E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |